View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11208_high_5 (Length: 238)
Name: NF11208_high_5
Description: NF11208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11208_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37028216 - 37027994
Alignment:
| Q |
1 |
tctccattgatggtgattttgacataacaaacatgttatacgcttgtttcatagttggtcgagaatgtggattcccactcaagcaagcaaatgccatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37028216 |
tctccattgatggtgattttgacataacaaacatgttatacgcttgtttcatagttggtcgagaatgtggattcccactcaagcaagcaaatgccatttt |
37028117 |
T |
|
| Q |
101 |
tgcaatcaagatcacatccttagcaactgaattttctggaagtggaagtcttgtgtctaatacatctttcaaaagcaaattatacgccattggtgcttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37028116 |
tgcaatcaagatcacatccttagcaactgaattttctggaagtggaagtcttgtgtctaatacatctttcaaaagcaaattatacgccattggtgcttca |
37028017 |
T |
|
| Q |
201 |
gatgatgagaacaatgttaaaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37028016 |
gatgatgagaacaatgttaaaat |
37027994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 112
Target Start/End: Complemental strand, 31217057 - 31217013
Alignment:
| Q |
68 |
tggattcccactcaagcaagcaaatgccatttttgcaatcaagat |
112 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
31217057 |
tggattctcactcaagcaagaaaatgccaattttgtaatcaagat |
31217013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University