View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1120_high_3 (Length: 446)
Name: NF1120_high_3
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1120_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 107 - 371
Target Start/End: Original strand, 37196620 - 37196884
Alignment:
| Q |
107 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtacgtttgtttttgttagctattttgatcattgtctcactttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37196620 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtccgtttgtttttgttagctattttgatcattgtgtcactttc |
37196719 |
T |
 |
| Q |
207 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196720 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
37196819 |
T |
 |
| Q |
307 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcatctc |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37196820 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcttctc |
37196884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 30 - 115
Target Start/End: Original strand, 37196513 - 37196598
Alignment:
| Q |
30 |
gtttaagttgtactataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactgcaattatctatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37196513 |
gtttaagttgtactataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactacaattatctatca |
37196598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University