View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1120_low_10 (Length: 319)
Name: NF1120_low_10
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1120_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 95 - 134
Target Start/End: Original strand, 1823677 - 1823716
Alignment:
| Q |
95 |
aaaatttcccttattgacatataaaattcgtttatgtcta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1823677 |
aaaatttcccttattgacatataaaattcgtttatgtcta |
1823716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University