View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1120_low_11 (Length: 296)
Name: NF1120_low_11
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1120_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 6 - 285
Target Start/End: Complemental strand, 32643923 - 32643644
Alignment:
| Q |
6 |
agaagcaaaggcatattgagtgtgtgaattcgtgatgtggtacctcgtgttgcaatcataattttgcttttcaaaactatctgcaaaacatcattaaaaa |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643923 |
agaaccaaaggcatattgagtgtgtgaattcgtgatgtggtacctcgtgttgcaatcataattttgcttttcaaaactatctgcaaaacatcattaaaaa |
32643824 |
T |
|
| Q |
106 |
ttcgagtgcatgtgttatttagaacattttttatgccggttattgccgtgtaccgtttcaagatgaacatctgaagagagatgtcctttttcacgagcct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643823 |
ttcgagtgcatgtgttatttagaacattttttatgccggttattgccgtgtgccttttcaagatgaacatctgaagagagatgtcctttttcacgagcct |
32643724 |
T |
|
| Q |
206 |
tgtagtcaagggcaatccacccccaattgggatggcaggttcatcctttcccaaaatttgcaagcatgttacagcttcat |
285 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32643723 |
tgtggtcaagggcaatccacccccaattgggatggcaggttcatcctttcccaaaatttgcaagcaagttacagcttcat |
32643644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University