View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1120_low_14 (Length: 256)
Name: NF1120_low_14
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1120_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 87 - 223
Target Start/End: Original strand, 35037878 - 35038013
Alignment:
| Q |
87 |
aaacatgtttagtaaaagatactgtaaacttcatgaaaaaattcttaccgagcatgtaaacattttggcaagttcgtcgatgtgagggagatcagaagca |
186 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037878 |
aaacatgtatagtaaaa-ataatgtaaacttcatgaaaaatttcttaccgagcatgtaaatattttggcaagttcgtcgatgtgagggagatcagaagca |
35037976 |
T |
 |
| Q |
187 |
gttgacggccaatcaggactcatctgagggtattatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037977 |
gttgacggccaatcaggactcatctgagggtattatt |
35038013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 35037597 - 35037658
Alignment:
| Q |
18 |
aatatctctaaacaaatctggtaaaatgtttaaaatcaacgtaagtcccaccaacaaagtat |
79 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35037597 |
aatatctctaaacaaatctggcaaaatggataaaatcaacgtaagtcccaccaacaaagtat |
35037658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University