View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1120_low_17 (Length: 220)
Name: NF1120_low_17
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1120_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 96 - 202
Target Start/End: Original strand, 2910500 - 2910606
Alignment:
| Q |
96 |
tgagatgaacctcgaatcatgacattatacataaatgtgtctggttggggaatttgagcaaacagttggtgtgcatagtttgtgacggttggagttgcag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2910500 |
tgagatgaacctcgaatcatgacattatacataaatgtgtctggttggggaatttgagcaaacagttggtgtgcatagtttgtgacggttggagttgcag |
2910599 |
T |
|
| Q |
196 |
tgggacc |
202 |
Q |
| |
|
||||||| |
|
|
| T |
2910600 |
tgggacc |
2910606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University