View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1120_low_17 (Length: 220)

Name: NF1120_low_17
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1120_low_17
NF1120_low_17
[»] chr7 (1 HSPs)
chr7 (96-202)||(2910500-2910606)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 96 - 202
Target Start/End: Original strand, 2910500 - 2910606
Alignment:
96 tgagatgaacctcgaatcatgacattatacataaatgtgtctggttggggaatttgagcaaacagttggtgtgcatagtttgtgacggttggagttgcag 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2910500 tgagatgaacctcgaatcatgacattatacataaatgtgtctggttggggaatttgagcaaacagttggtgtgcatagtttgtgacggttggagttgcag 2910599  T
196 tgggacc 202  Q
    |||||||    
2910600 tgggacc 2910606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University