View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1120_low_8 (Length: 400)
Name: NF1120_low_8
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1120_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 30 - 256
Target Start/End: Original strand, 42518938 - 42519164
Alignment:
| Q |
30 |
tgaagatgaataactcagtagcttcagagaacagttttattattgaaagtgatgaagaagatgataaggattttaacaaaggtgatgatggaaatgattc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518938 |
tgaagatgaataactcagtagcttcagagaacagttttattattgaaagtgatgaagaagatgataaggattttaacaaaggtgatgatggaaatgattc |
42519037 |
T |
 |
| Q |
130 |
tgattcttccaattactcaaatgaaaatccaccacagaggaaacaaagttcttataatccatcatggcctcagagttacaggttaagtccttttttcaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519038 |
tgattcttccaattactcaaatgaaaatccaccacagaggaaacaaagttcttataatccatcatggcctcagagttacaggttaagtccttttttcaat |
42519137 |
T |
 |
| Q |
230 |
ccccctagatttcagtgcacctgtgtg |
256 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42519138 |
ccccctagatttcagtgcacctgtgtg |
42519164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University