View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1120_low_9 (Length: 326)
Name: NF1120_low_9
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1120_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 153 - 311
Target Start/End: Original strand, 52391502 - 52391654
Alignment:
| Q |
153 |
ttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacaggaattctgttccaattttgagagtttaaaaggta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
52391502 |
ttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacc------ctgttccaattttgagagtttgaaaggta |
52391595 |
T |
|
| Q |
253 |
tgagaagggatggcttcagaggtggaaaatataggagggaatgtggaaatcttgtacat |
311 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391596 |
tgagaagggatgacttcagagttggaaaatataggagggaatgtggaaatcttgtacat |
52391654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 29 - 68
Target Start/End: Original strand, 52391206 - 52391245
Alignment:
| Q |
29 |
aaaataatcatcatattacaaacatggataattttcttta |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391206 |
aaaataatcatcatattacaaacatggataattttcttta |
52391245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University