View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11211_high_12 (Length: 280)

Name: NF11211_high_12
Description: NF11211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11211_high_12
NF11211_high_12
[»] chr4 (1 HSPs)
chr4 (18-268)||(21343752-21344002)


Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 21344002 - 21343752
Alignment:
18 atgaattggcacgttggttccaccaaactgaagaaccacccagtaaaaactaaaaaccacattgcatgcacaccaaaactaactactaagctttatgaaa 117  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21344002 atgaattggcacggtggttccaccaaactgaagaaccacccagtaaaaactaaaaaccacattgcatgcacaccaaaactaactactaagctttatgaaa 21343903  T
118 ttttagttagcatataaatataataactgcaagtacatgaaggatgaaaattggttaggaataaattaaaatctcactttgaggtaagcagtgaagtgat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21343902 ttttagttagcatataaatataataactgcaagtacatgaaggatgaaaattggttaggaataaattaaaatctcactttgaggtaagcagtgaagtgat 21343803  T
218 attgggcgctgtacaactacatccatttagattactgacttgttctgttct 268  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||    
21343802 attgggcgctgtacaactacatccatttagataactgacttgttctgttct 21343752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University