View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11211_high_17 (Length: 249)

Name: NF11211_high_17
Description: NF11211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11211_high_17
NF11211_high_17
[»] chr5 (1 HSPs)
chr5 (1-157)||(2379993-2380149)
[»] chr1 (1 HSPs)
chr1 (1-70)||(45779864-45779934)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 2379993 - 2380149
Alignment:
1 attgaatggttcgttgaattcaaattgaagttgggaaattgcataatctgaagctcaatcgatttcagaagggtatgacaattctgtaaaccctaacacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2379993 attgaatggttcgttgaattcaaattgaagttgggaaattgcataatctgaagctcaatcgatttcagaagggtatgacaattctgtaaaccctaacacg 2380092  T
101 atggggattggggaagagagagtcatgcgcttcttctgaagtttgttaaaacgctga 157  Q
    |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||    
2380093 atggggatcggggaagagagagtcatgcgcttcttctgaggtttgttaaaacgctga 2380149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 45779864 - 45779934
Alignment:
1 attgaatggttcgttgaattcaaattgaagttgggaaattgcataatctgaagctc-aatcgatttcagaa 70  Q
    |||| |||| |||||||||||||||||| |||||||||||||||| | |||||||| ||||||||||||||    
45779864 attgtatggctcgttgaattcaaattgaggttgggaaattgcatattttgaagctcaaatcgatttcagaa 45779934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University