View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11211_high_7 (Length: 353)
Name: NF11211_high_7
Description: NF11211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11211_high_7 |
 | |
|
| [»] scaffold0176 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 38724972 - 38724860
Alignment:
| Q |
1 |
tgaagattccgccccaacgaacttcacttgcaaatgcaagcaaggacatgaatgttgcacttcctccttattcagttgcatcgatcgatctattaatttg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38724972 |
tgaagatttcgccccaacgaacttcacttgcaaatgcaagcaaggacatgtatgttgcacttcatccttattcagttgcatcgattgatctattaatttg |
38724873 |
T |
|
| Q |
101 |
aaatgctatggtg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38724872 |
aaatgctatggtg |
38724860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 277 - 338
Target Start/End: Complemental strand, 38724748 - 38724687
Alignment:
| Q |
277 |
caaaaagatttacatttactaagagatgtaaatggatatcatggatgctaatagtatgacat |
338 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38724748 |
caaaaatatttacatttactcacggatgtaaatggatatcatggatgcagatagtatgacat |
38724687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 82
Target Start/End: Original strand, 32675 - 32746
Alignment:
| Q |
11 |
gccccaacgaacttcacttgcaaatgcaagcaaggacatgaatgttgcacttcctccttattcagttgcatc |
82 |
Q |
| |
|
||||||| ||||| |||||| |||||||||||| |||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
32675 |
gccccaaagaactgcacttggaaatgcaagcaatgacatggatgttagacttcctccttattcagttacatc |
32746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 82
Target Start/End: Original strand, 34165854 - 34165925
Alignment:
| Q |
11 |
gccccaacgaacttcacttgcaaatgcaagcaaggacatgaatgttgcacttcctccttattcagttgcatc |
82 |
Q |
| |
|
||||||| ||||| |||||| |||||||||||| |||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
34165854 |
gccccaaagaactgcacttggaaatgcaagcaatgacatggatgttagacttcctccttattcagttacatc |
34165925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 82
Target Start/End: Original strand, 34215948 - 34216019
Alignment:
| Q |
11 |
gccccaacgaacttcacttgcaaatgcaagcaaggacatgaatgttgcacttcctccttattcagttgcatc |
82 |
Q |
| |
|
||||||| ||||| |||||| |||||||||||| |||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
34215948 |
gccccaaagaactgcacttggaaatgcaagcaatgacatggatgttagacttcctccttattcagttacatc |
34216019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University