View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11211_low_18 (Length: 249)
Name: NF11211_low_18
Description: NF11211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11211_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 2379993 - 2380149
Alignment:
| Q |
1 |
attgaatggttcgttgaattcaaattgaagttgggaaattgcataatctgaagctcaatcgatttcagaagggtatgacaattctgtaaaccctaacacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2379993 |
attgaatggttcgttgaattcaaattgaagttgggaaattgcataatctgaagctcaatcgatttcagaagggtatgacaattctgtaaaccctaacacg |
2380092 |
T |
 |
| Q |
101 |
atggggattggggaagagagagtcatgcgcttcttctgaagtttgttaaaacgctga |
157 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2380093 |
atggggatcggggaagagagagtcatgcgcttcttctgaggtttgttaaaacgctga |
2380149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 45779864 - 45779934
Alignment:
| Q |
1 |
attgaatggttcgttgaattcaaattgaagttgggaaattgcataatctgaagctc-aatcgatttcagaa |
70 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||||||||| | |||||||| |||||||||||||| |
|
|
| T |
45779864 |
attgtatggctcgttgaattcaaattgaggttgggaaattgcatattttgaagctcaaatcgatttcagaa |
45779934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University