View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11211_low_21 (Length: 205)

Name: NF11211_low_21
Description: NF11211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11211_low_21
NF11211_low_21
[»] chr5 (2 HSPs)
chr5 (108-187)||(175719-175798)
chr5 (11-66)||(175794-175849)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 108 - 187
Target Start/End: Complemental strand, 175798 - 175719
Alignment:
108 aaattgagcgtgaggcgggttttactgaaatatggaatgggaaatgagtgcttcgttgttacagaatttgaagttacacg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
175798 aaattgagcgtgaggcgggttttactgaaatatggaatgggaaatgagtgcttcgttgttacagaatttgaagttacacg 175719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 11 - 66
Target Start/End: Complemental strand, 175849 - 175794
Alignment:
11 agagaagaagaacccagtgagtgacatggagtaaagtaaagttgttcttgcaaatt 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
175849 agagaagaagaacccagtgagtgacatggagtaaagtaaagttgttcttgcaaatt 175794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University