View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11211_low_21 (Length: 205)
Name: NF11211_low_21
Description: NF11211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11211_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 108 - 187
Target Start/End: Complemental strand, 175798 - 175719
Alignment:
| Q |
108 |
aaattgagcgtgaggcgggttttactgaaatatggaatgggaaatgagtgcttcgttgttacagaatttgaagttacacg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175798 |
aaattgagcgtgaggcgggttttactgaaatatggaatgggaaatgagtgcttcgttgttacagaatttgaagttacacg |
175719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 11 - 66
Target Start/End: Complemental strand, 175849 - 175794
Alignment:
| Q |
11 |
agagaagaagaacccagtgagtgacatggagtaaagtaaagttgttcttgcaaatt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175849 |
agagaagaagaacccagtgagtgacatggagtaaagtaaagttgttcttgcaaatt |
175794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University