View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11212_high_3 (Length: 491)
Name: NF11212_high_3
Description: NF11212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11212_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 116 - 458
Target Start/End: Complemental strand, 53679605 - 53679263
Alignment:
| Q |
116 |
acctgcttaatcaacattgaatcacctttcttactttcgtttgattttcttgaaaatccatccatttagatcagaaatagaacctaattgaattgatttt |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53679605 |
acctgcttaatcaacaccgaatcacctttcttactttcgtttgattttcttgaaaatccatccatttagatcagaaatagaacctaattgaattgatttt |
53679506 |
T |
|
| Q |
216 |
acatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaagtttcaattttgttcaccacgtttaacgttttaaatatgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53679505 |
acatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaaatttcaattttgttcaccatgtttaacgttttaaatatgt |
53679406 |
T |
|
| Q |
316 |
catgtttcagttctgtttttaagctagttatattctggtccaatttcacttcttgttaaaacagttcagttagtaaccagaccttttcatatggttcagt |
415 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53679405 |
tatgtttcagttttgtttttaagctagttatattctggttcaatttcagttcttgttaaaacagttcagttagtaaccagaccttttcatatggttcagt |
53679306 |
T |
|
| Q |
416 |
ctgaacatttataaaccagtttagtttaataacagtttggttc |
458 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53679305 |
ctgaacatttataaaccagtttagttcaataacagtttggttc |
53679263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Original strand, 2045022 - 2045066
Alignment:
| Q |
371 |
ttaaaacagttcagttagtaaccagaccttttcatatggttcagt |
415 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
2045022 |
ttaaaacagttcagctaataaccaatccttttcatatggttcagt |
2045066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University