View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11214_high_11 (Length: 320)
Name: NF11214_high_11
Description: NF11214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11214_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 73 - 310
Target Start/End: Original strand, 9336584 - 9336821
Alignment:
| Q |
73 |
cacagtctttttgagaaaatgacctaacagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgagacatt |
172 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9336584 |
cacagtctttttgagaaaatgacctaccagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgaaacatt |
9336683 |
T |
 |
| Q |
173 |
aaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcacctcccggttcgaatg |
272 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
9336684 |
aaccgaattcaaggatgcgagggtccttaggatcgatgatggatttacagatagaagccaaatcgatattcgcttcacttcgcacctcccagttcgaatg |
9336783 |
T |
 |
| Q |
273 |
aaaacgactatccttccattctgataacattattcttc |
310 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9336784 |
aaaaagactatccttccattctgataacattattcttc |
9336821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 9336545 - 9336593
Alignment:
| Q |
20 |
gggactgtgttggctttctcttcatgtgatattccttgtcacagtcttt |
68 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9336545 |
gggactgtcttggctttctcttcgtgtgatattccttgtcacagtcttt |
9336593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 242
Target Start/End: Original strand, 8209356 - 8209426
Alignment:
| Q |
172 |
taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatatt |
242 |
Q |
| |
|
|||||||||| | | |||||| |||| ||||||||||||||||| | | ||| |||||| ||||||||||| |
|
|
| T |
8209356 |
taaccgaattgacgaatgcgaggatcgttaggatcggtgatggagtgaaagagagaagctaaatcgatatt |
8209426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 172 - 257
Target Start/End: Original strand, 42365183 - 42365268
Alignment:
| Q |
172 |
taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcac |
257 |
Q |
| |
|
|||||||||||| |||||||| | || |||||||||||||| || | ||||| |||||||| ||| ||||| ||||| ||||||| |
|
|
| T |
42365183 |
taaccgaattcacggatgcgagggtctttaggatcggtgattgagtcacagagagaagccagatcaatattggcttcatttcgcac |
42365268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University