View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11214_high_18 (Length: 221)
Name: NF11214_high_18
Description: NF11214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11214_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 39145023 - 39145214
Alignment:
| Q |
14 |
cacagataaatgcatgtgttgggatgcaacaagcctgctaaacctttttaaggactctcttcctgtcttcatcatgccagagaacggtgactggcgttgg |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39145023 |
cacaaataaatgcatgtgttgggatgcaacaagcctgctaaacctttttaaggactctcttcctgtcttcatcatgccagagaacggtgactggcgttgg |
39145122 |
T |
 |
| Q |
114 |
ccaatatttaccgataccatggacctcccaacgacaatgctggtatcaactcgtcgcggtaatacaagaggccaccataccttgcgcctttt |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39145123 |
ccaatacttaccgataccatggacctcccaacgacaatgctggtatcaactcgtcgcggtaatacaagaggccaccataccttgcgcctttt |
39145214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 44696922 - 44696865
Alignment:
| Q |
24 |
tgcatgtgttgggatgcaacaagcctgctaaacctttttaaggactctcttcctgtct |
81 |
Q |
| |
|
||||| |||||||||||||||||||| | ||||||||| ||||||| ||| ||||||| |
|
|
| T |
44696922 |
tgcatatgttgggatgcaacaagcctacaaaaccttttcaaggactttctacctgtct |
44696865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University