View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11214_high_19 (Length: 218)
Name: NF11214_high_19
Description: NF11214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11214_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 121
Target Start/End: Complemental strand, 37801818 - 37801703
Alignment:
| Q |
4 |
cccatgacagacaaaacaatgaaacaacatattcacataataaacttgatatataaaagattgccnnnnnnnnnnnnctttgatatttatataagatggg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37801818 |
cccatgacagacaaaacaatgaaacaacatattcacataataaatttgatatataaaagattgcc--aaaaaaaaaactttgatatttatataagatggg |
37801721 |
T |
 |
| Q |
104 |
ttatgcttgttaaagatt |
121 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37801720 |
ttatgcttgttaaagatt |
37801703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University