View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11214_low_12 (Length: 300)
Name: NF11214_low_12
Description: NF11214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11214_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 42146590 - 42146798
Alignment:
| Q |
15 |
gatgagagcggaagggagcaaaatggagccagaaactcattgtttgggttagtgtcttgtaagagtgggaaatgacaagacttg-attaatattttcttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42146590 |
gatgagagcggaagggagcaaaatggagccagaaactcattgtttgggttagtgtcttgtaagagtgggaaatgacaagacttggattaatattttcttt |
42146689 |
T |
|
| Q |
114 |
attttgactgtattattaaaagatagatggtttggagatctcttcaactctcccatctccatctctttaaacccctttcacccacctctcccaccctacc |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42146690 |
attttgactgtattattagaagatagatggtttggagatctcttcaactctcccatctccatctctttaaacccctttcacccacctctcccaccctacc |
42146789 |
T |
|
| Q |
214 |
actattaat |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
42146790 |
actattaat |
42146798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 223 - 282
Target Start/End: Original strand, 42147659 - 42147718
Alignment:
| Q |
223 |
ctgcccaactaaacaccaagtgttgatgagtgaagagttgagagttcgaacctacgtccc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42147659 |
ctgcccaactaaacaccaagtgttgatgagtgaagagttgagagttcgaacctacgtccc |
42147718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University