View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11214_low_14 (Length: 276)
Name: NF11214_low_14
Description: NF11214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11214_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 20 - 265
Target Start/End: Original strand, 36915478 - 36915720
Alignment:
| Q |
20 |
ccccatgcaattgtgtgaatgggaaactgtattaacctcannnnnnnnn-cacgtcaagaacagaagnnnnnnnnccaactgatcgataattatatagac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
36915478 |
ccccatgcaattgtgtgaatgggaaactgtattaacctcattttttttttcacgtcaagaacagaa----aaaaaccaacggatcgataattatatagac |
36915573 |
T |
 |
| Q |
119 |
ttaattccattttatatgtatcaatagaatccgttagacttttgagtagcttccccaaccccatggtccaactttgcttgcttgctaccatccaacttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36915574 |
ttaattccattttatatgtatcaatagaatccgttagacttttgagtagcttccccaaccccatggtccaactttgcttgcttgctaccatccaacttta |
36915673 |
T |
 |
| Q |
219 |
acccaaagtgaatgtgaggaaaatgtgcccactgcatatatattcat |
265 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36915674 |
atccaaagtgaatgtgaggaaaatgtgcccactgcatatatattcat |
36915720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 258
Target Start/End: Complemental strand, 17804139 - 17804101
Alignment:
| Q |
220 |
cccaaagtgaatgtgaggaaaatgtgcccactgcatata |
258 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
17804139 |
cccaaagtgaatatgagggaaatgtgcccactgcatata |
17804101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University