View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11215_low_6 (Length: 352)
Name: NF11215_low_6
Description: NF11215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11215_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 46922130 - 46922461
Alignment:
| Q |
1 |
aaaggagggtaaatttgatactattgttgaaaataaaaacaagcccttttctgaattttttacctttccacaatactcaacaagtgacggtgtgtgtgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46922130 |
aaaggagggtaaatttgatactattgttgaaaataaaaacaagcccttttctgaattttttacctttccacaatactcaacaagtgacggtgtgtgtgag |
46922229 |
T |
 |
| Q |
101 |
agttctgagacaaaaatgggtggtgaggttcaatctcgcaatattgctgatattgaagtgacaatggttgaaagccatgcaaatctcaaaataagaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46922230 |
agttctgagacaaaaatgggtggtgaggttcaatctcgcaatattgctgatattgaagttacaatggttgaaagccatgcaaatctcaaaataagaacaa |
46922329 |
T |
 |
| Q |
201 |
agaaaagaccaaaacagctcttgaagatggtttctagtttgcatggattgtgtctcacaatcttgcaccttaatgtcactacagctgatgaatttgtctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46922330 |
agaaaagaccaaaacagctcttgaagatggtttctagtttgcatggattgtgtctcacaatcttgcaccttaatgtcactacagctgatgaatttgtctt |
46922429 |
T |
 |
| Q |
301 |
ctattctctcagcgttaaggtaattgtctgtg |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46922430 |
ctattctctcagcgttaaggtaattgtctgtg |
46922461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 143 - 243
Target Start/End: Complemental strand, 36675915 - 36675815
Alignment:
| Q |
143 |
attgctgatattgaagtgacaatggttgaaagccatgcaaatctcaaaataagaacaaagaaaagaccaaaacagctcttgaagatggtttctagtttgc |
242 |
Q |
| |
|
|||||||| || |||||||||||||| |||| |||||||||||| ||||||||| ||| || || ||||| ||||||||||| || || ||| |||||| |
|
|
| T |
36675915 |
attgctgacatagaagtgacaatggtggaaaaccatgcaaatcttaaaataagatcaagaaagaggccaaagcagctcttgaaaattgtatctggtttgc |
36675816 |
T |
 |
| Q |
243 |
a |
243 |
Q |
| |
|
| |
|
|
| T |
36675815 |
a |
36675815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University