View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11215_low_9 (Length: 248)
Name: NF11215_low_9
Description: NF11215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11215_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 217
Target Start/End: Complemental strand, 35399684 - 35399479
Alignment:
| Q |
12 |
ttggaaggaggaataagacatctcaacggctgatgagaaaatatggtagaaatttcaacgcatgtgttttgttatacttgtatataatggtaaaggatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35399684 |
ttggaaggaggaataagacatctcaacggctgatgagaaaatatggtagaaatttcaacgcatgtgttttgttatacttgtatataatggtaaaggatgt |
35399585 |
T |
 |
| Q |
112 |
cttacttttccctcgaaagcaagggctctctttagaagaatcaattcgtaaggtaaaaagctctttggaaatatcattcagttgtcttctttaaaacttg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35399584 |
cttacttttccctctaaagcaagggctctctttagaagaatcaattcgtaacgtaaaaagctctttggaaatatcattcagttgtcttctttaaaacttg |
35399485 |
T |
 |
| Q |
212 |
taaata |
217 |
Q |
| |
|
|||||| |
|
|
| T |
35399484 |
taaata |
35399479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University