View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11216_low_3 (Length: 265)
Name: NF11216_low_3
Description: NF11216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11216_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 14748839 - 14748608
Alignment:
| Q |
18 |
gaaactatgtgcatgcaccagcatcctagtttttgcaatcccaatacgttgattacatatgatttttaaagaagtcactctttgtactcaaacaagcacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14748839 |
gaaactatgtgcatgcaccagcatcctagtttttgcaatcc-aatactttgattacatatgatttttaaagaagtcactctttgtactcaaacaagcacc |
14748741 |
T |
 |
| Q |
118 |
gtgcttaattagtaccagtgttttatttattttgtctctacattagatttcactcataggggctgaaatcattatttacttatcaccgcaatggataaca |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14748740 |
gtgctta----gtaccagtgttttatttattttatctctacattagatttcactcataggggctgaaatcattatttacttatcaccgcaat-gataaca |
14748646 |
T |
 |
| Q |
218 |
catcttacaatcttctctatgtgggtgaaattattctt |
255 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14748645 |
catcttacaatcttctctaagtgggtgaaattattctt |
14748608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University