View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11217_low_22 (Length: 300)
Name: NF11217_low_22
Description: NF11217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11217_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 8800793 - 8801073
Alignment:
| Q |
1 |
aaactactatattcaagctgcaagaacattgatcatgttatatcgctatttannnnnnnnnnnnngccacattagagtgatgttgtggaaagttcttgtt |
100 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8800793 |
aaactattatattcaagctgtaagaacattgatcatcatatatcgctatttatttattttttt--gccacattagagtgatgttgtggaaagttcttgtt |
8800890 |
T |
 |
| Q |
101 |
ccagcttaacannnnnnnnnnnnnncagacgatctaagccctttttaaacaatcactttccacgtttggcttaggcgtactatgcagtttctcaaaagag |
200 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8800891 |
ccagcttaacatttttttgctttttcagacgatctaaaccctttttaaacaatcactt-ccacgtttggcttaggcgtactgtgcagtttctcaaaagag |
8800989 |
T |
 |
| Q |
201 |
gtttaatcaaagtttggtagtgcctataaatggataagatcattaagcaaattgtcaacnnnnnnnnctgaaacttttcaaaag |
284 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8800990 |
gtttaatcaaaatttggtagtgcctataaatggataagatcattaagcaaattgtcaacttttttttctgaaacttttcaaaag |
8801073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University