View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11217_low_24 (Length: 282)
Name: NF11217_low_24
Description: NF11217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11217_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 7491279 - 7491016
Alignment:
| Q |
1 |
aaaagaggtaaaactgcatttttatgaccgtgttcagtttagttcatgttgtagcagtttagattgtaaatgtgaaagctggtgtagttttcataatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
7491279 |
aaaagaggtaaaactgcatttttatgaccgtgttcagtttagttcatgctgtagcagtttagattgtaaatgtgaaagctggtgcagatttcataatcca |
7491180 |
T |
|
| Q |
101 |
ctagtagccttgttctctaatagttttcaaagactgcttcatctagaattatttcttactgatataactcttgaaacttaggttacgaaaagggcatgca |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
7491179 |
ctattagccttgttctctaatagttttcaaagactgcttcatctagaattatttcttactgataagactcttgaaacttaggttccgaaaagggcatgca |
7491080 |
T |
|
| Q |
201 |
aatctgttaaattttaacaagtcttgcttgtttttgttatgccctgaggttgtaggactttatt |
264 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
7491079 |
aatgtgttaaattttaacaagtcttgcttgtttttgttatgctctgagcttgtaggactttatt |
7491016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 102
Target Start/End: Complemental strand, 48872272 - 48872201
Alignment:
| Q |
31 |
tgttcagtttagttcatgttgtagcagtttagattgtaaatgtgaaagctggtgtagttttcataatccact |
102 |
Q |
| |
|
|||| |||| |||||||| |||||||||| || ||| |||||||||||||| || ||||||||||| ||||| |
|
|
| T |
48872272 |
tgtttagttcagttcatgctgtagcagttcagtttgaaaatgtgaaagctgatgcagttttcataaaccact |
48872201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 102
Target Start/End: Complemental strand, 48877576 - 48877505
Alignment:
| Q |
31 |
tgttcagtttagttcatgttgtagcagtttagattgtaaatgtgaaagctggtgtagttttcataatccact |
102 |
Q |
| |
|
|||| |||| |||||||| |||||||||| || ||| |||||||||||||| || ||||||||||| ||||| |
|
|
| T |
48877576 |
tgtttagttcagttcatgctgtagcagttcagtttgaaaatgtgaaagctgatgcagttttcataaaccact |
48877505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University