View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11217_low_26 (Length: 271)
Name: NF11217_low_26
Description: NF11217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11217_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 23 - 261
Target Start/End: Complemental strand, 52124261 - 52124023
Alignment:
| Q |
23 |
taaataaattacatataatggagagaacctatnnnnnnnntaccgtaacttatttgatcatatactctaaaagacatttattccttctcaaannnnnnnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52124261 |
taaataaattacatataatggagagaacctataaaaaaaataccgtaacttatttgatcatatactctaaaagacatttattccttctcaatattttttt |
52124162 |
T |
|
| Q |
123 |
nnnggtacatccttctcaatattgttattagttataaggtgcaaagagagttaactagtaaaattaattaagaaaattgcatcagttagctgattgctga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52124161 |
tttggtacatccttctcaatattgttattagttataaggtgcaaagagagttaactagtaaaattaattaagaaaattgcatcagttagctgattgctga |
52124062 |
T |
|
| Q |
223 |
ttatatggtgttactattaatattcaccttcatcctttg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52124061 |
ttatatggtgttactattaatattcaccttcatcctttg |
52124023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University