View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11217_low_29 (Length: 247)
Name: NF11217_low_29
Description: NF11217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11217_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 39396068 - 39396305
Alignment:
| Q |
1 |
taacacacactaagtttgatgaaatcatggtggattctgggattcttttgaagctcgaagtgtaatttttgctaaatttgcggcgacacattgcactaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396068 |
taacacacactaagtttgatgaaatcatggtggattctgggattcttttgaagctcgaagtgtaatttttgctaaatttgcggcgacacattgcactaag |
39396167 |
T |
|
| Q |
101 |
tttgacgaaatcaatgtggtaattgagattttgttgaagtttcaaagtgcagttttttgctaaaatcacggtggcacaacttaaatattccaaacacaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396168 |
tttgacgaaatcaatgtggtaattgagattttgttgaagtttcaaagtgcagttttttgctaaaatcacggtggcacaacttaaatattccaaacacact |
39396267 |
T |
|
| Q |
201 |
actccaatgtttggtattcctttctcacgtccctatgc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396268 |
actccaatgtttggtattcctttctcacgtccctatgc |
39396305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 17899511 - 17899465
Alignment:
| Q |
127 |
gattttgttgaagtttcaaagtgcagttttttgctaaaatcacggtgg |
174 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
17899511 |
gattttgttgaagtttcaaagtatag-tttttgctaaaatcacggtgg |
17899465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University