View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11217_low_30 (Length: 245)
Name: NF11217_low_30
Description: NF11217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11217_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 11012786 - 11012555
Alignment:
| Q |
1 |
taactgattaaataatatgcaattcattcgcacttcttagtctataaggtctaactcaatcaataaaattctcaaaattgttataccgaatattgtgact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11012786 |
taactgattaaataatatgcaattcattcgcacttcttagtctataaggtctaactcaatcaataaaattctcaaaattgttatatcgaatattgtgact |
11012687 |
T |
|
| Q |
101 |
gcagtttaaaacctcagttactccacttatgtgtgtgagttttcgatggatattgtcatgttgtctatcta-cccnnnnnnnnnnnnnttcgcactttag |
199 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
11012686 |
gcggttt-aaacctcagttactccacttatgtgtgtgagtttttgatagatattgtcatgttgtctatctaccccaaaaaaaaaaaaaatcgcactttag |
11012588 |
T |
|
| Q |
200 |
accgtgtaaaaatatttgcgttagagaatgatg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11012587 |
accgtgtaaaaatatttgcgttagagaatgatg |
11012555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University