View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11217_low_33 (Length: 228)
Name: NF11217_low_33
Description: NF11217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11217_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 33636914 - 33636720
Alignment:
| Q |
19 |
agatctgccatgtcctttcgccgtgtttattcatttttgccgtcagctcaactgctactgtgattttcttgattgatactcatacattctttatcaaagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33636914 |
agatctgccatgtcctttcgccgtgtttattcatttttgccgtcagctcaactgctactgtgattttcttgattgatactcatacattctttatcaaagt |
33636815 |
T |
|
| Q |
119 |
agagtcatttaaaatcttattatctgcatatgatttgtatttttatctacatgtattaacacttgagtttccccataaaaacaatctcttctgtg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33636814 |
agagtcatttaaaatcttattatctgcatatgatttgtatttttatctacatgtattaacacttgagtttccccataaaaacaatctcttctgtg |
33636720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 171 - 209
Target Start/End: Complemental strand, 4691141 - 4691103
Alignment:
| Q |
171 |
gtattaacacttgagtttccccataaaaacaatctcttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4691141 |
gtattaacacttgagtttccccataaaaacaatctcttc |
4691103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University