View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11217_low_36 (Length: 202)
Name: NF11217_low_36
Description: NF11217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11217_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 17 - 181
Target Start/End: Complemental strand, 42823492 - 42823318
Alignment:
| Q |
17 |
cacagaaggaacaacaattcatgaaaaagaaaatcaatttcatggacaaaagataatgaagaaaaacacccaaattcaaattttacaaagaatcaattca |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42823492 |
cacagaaggaacaacaattcatcaaaaagaaaatcaatttcatggacaaaagataatgaagaaaaacacccaaattcaaattttacaaagaatcaattca |
42823393 |
T |
|
| Q |
117 |
agaaaagatgt----------taggggaactttcgtctttttgaccaaaatttatgtcattctctcgcttttttc |
181 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
42823392 |
agaaaagatgttaggtaatgttaggggaactttcgtctttttgaccaaaatttgtgtcattctctcacttttttc |
42823318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 124 - 184
Target Start/End: Complemental strand, 33073111 - 33073051
Alignment:
| Q |
124 |
atgttaggggaactttcgtctttttgaccaaaatttatgtcattctctcgcttttttcagt |
184 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
33073111 |
atgttaggggaactttcttctttttgaccaaaatttgtgtcattatctcgcttttttcagt |
33073051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University