View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_high_18 (Length: 384)
Name: NF11218_high_18
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_high_18 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 221 - 384
Target Start/End: Complemental strand, 37653644 - 37653481
Alignment:
| Q |
221 |
aagctttggtgaagagtgctccttggccaaatgtggaagaatgatcggctgcgttgacaccgatggtgatggcagaattgatttctatgaatttagaatc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37653644 |
aagctttggtgaagagtgctccttggccaaatgtggaagaatgataggctgcgttgacaccgatggtgatggcagaattgatttcgatgaatttagaatc |
37653545 |
T |
 |
| Q |
321 |
atgatgatggacatgtagttcttccctctgccactggatcaaagtcattcttcaaattgttatt |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37653544 |
atgatgatggacatgtagttcttccctctgccactggatcgaagtcattcttcaaattgttatt |
37653481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 69 - 329
Target Start/End: Complemental strand, 37655631 - 37655371
Alignment:
| Q |
69 |
ggaggatttatcacactccaagagtttattgagctaagcaccacgaaatctgaaactgaagaggacatagaaaacataaaaaacgcctttgatgtttttg |
168 |
Q |
| |
|
||||||| |||||| || ||||||||||||||||||||||| || | | |||| |||||||||| ||||||||| |||| | | | ||| ||| | || |
|
|
| T |
37655631 |
ggaggatctatcacgcttcaagagtttattgagctaagcacaacaagctatgaatctgaagaggaaatagaaaacctaaagagcacgttttctgtgtatg |
37655532 |
T |
 |
| Q |
169 |
acattgatggtgacggtttcatcaccgtggaggagctcaatacggttatgaaaagctttggtgaagagtgctccttggccaaatgtggaagaatgatcgg |
268 |
Q |
| |
|
|||||||||| || ||||||||||| | | ||||||| || ||| |||||| |||| ||||| ||||||| ||||||| |||||| |||||| || || |
|
|
| T |
37655531 |
acattgatggcgatggtttcatcacggcgaaggagcttaacacgcttatgagaagcattggtcaagagtgttccttggatgaatgtgaaagaattattgg |
37655432 |
T |
 |
| Q |
269 |
ctgcgttgacaccgatggtgatggcagaattgatttctatgaatttagaatcatgatgatg |
329 |
Q |
| |
|
||||||| | ||||||||||| || |||||||| | || |||||||||||||||||| |
|
|
| T |
37655431 |
tcgcgttgatagtgatggtgatggtaggattgattttgaggattttagaatcatgatgatg |
37655371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University