View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_high_31 (Length: 281)
Name: NF11218_high_31
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 159 - 265
Target Start/End: Original strand, 4198565 - 4198669
Alignment:
| Q |
159 |
gtccccactttccattttgttagtgaaagaagttgtattataaacatgaaaaagaagtttaaggtgtccaaattatcctcaatacatgaggcaggcaatc |
258 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4198565 |
gtccccattttccattttgttagtgaaagaagttgtattataaacatgaaaaagaagtttaag--gtccaaattatcctcaatacatgaggcaggcaatc |
4198662 |
T |
|
| Q |
259 |
ttgaaac |
265 |
Q |
| |
|
||||||| |
|
|
| T |
4198663 |
ttgaaac |
4198669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 14 - 148
Target Start/End: Original strand, 4197659 - 4197808
Alignment:
| Q |
14 |
agaggttgtaacttcttgttaaaggttaggtaattggacact---------------tacattgtgtcagtttaataattgcatttagacaacgatatgt |
98 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
4197659 |
agaggttgtaacttcttgttacaggttaggtaattggacactgattgatatgctttttacattgtgtcagcttaataattgcatttagacaaggatatgt |
4197758 |
T |
|
| Q |
99 |
gctcttttgagggcagtccatgtattctggttgtgtcaagacaactttga |
148 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4197759 |
gctcttttgagggcagcccatgtattctggttgtgtcaagacaactttga |
4197808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University