View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_high_40 (Length: 239)
Name: NF11218_high_40
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 30615563 - 30615342
Alignment:
| Q |
4 |
cttaatgtaggtctcacttaaaattgaaatgcttcattgggactttgatcccattaggtactcaa--taactttttcttaatggggtacctcgtatgtat |
101 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||| |
|
|
| T |
30615563 |
cttaatgtaggtctcacctaaaattgaaatgcttcattgggactttgatcccattaggtactcaaaataacttttccttaatggggtacctcatatgtat |
30615464 |
T |
|
| Q |
102 |
cgggtcttgaatggagaaataccccattaaagatggtcttaaagtctccaaaattttgaaacttgcccccaacttcattactttaaaagcaattgaatat |
201 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30615463 |
cgggtcttgaatggagagatcccccattaaagatggtcttaaagtctccaaaattttgaaacttgcccccaacttcattactttaaaagcaattgaatat |
30615364 |
T |
|
| Q |
202 |
tgtttcggagacaaataataat |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30615363 |
tgtttcggagacaaataataat |
30615342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University