View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_high_41 (Length: 230)
Name: NF11218_high_41
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 26416640 - 26416837
Alignment:
| Q |
16 |
agagatgttaggtttgttaatcaatatctattgaatattttgtatgattccacaaagtctaatctgaatacgcagaactcatgcaaggtgtcttccaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26416640 |
agagatgttaggtttgttaatcaatatctattgaatattttgtatgattccacaaagtctaatctgaatacgcagaactcatgcaaggtgtcttccaatt |
26416739 |
T |
 |
| Q |
116 |
caaacttctaggttctttagacaataaccttctagagaata-tttattcacggtccttttagaggatgagatctttgatcactgaaggatcacctttg |
212 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26416740 |
caaacttctaggatctttggacaataaccttctagagaatattttattcacagtccttttaaaggatgagatctttgatcactgaaggatcacctttg |
26416837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University