View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11218_high_45 (Length: 214)

Name: NF11218_high_45
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11218_high_45
NF11218_high_45
[»] chr7 (1 HSPs)
chr7 (19-199)||(42879279-42879459)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 42879279 - 42879459
Alignment:
19 aggcccctgtcgagttcttaatttctgcctccatatttagaggctaatctgtagctatgcaactaaatgctttgcatgcatttcaatgagaggggtttga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42879279 aggcccctgtcgagttcttaatttctgcctccatatttagaggctaatctgtagctatgcaactaaatgctttgcatgcatttcaatgagaggggtttga 42879378  T
119 gaattcaattcaaactttcatcaattgagtattaatatttatggctatgatctgcttggattgtactatactatattatct 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42879379 gaattcaattcaaactttcatcaattgagtattaatatttatggctatgatctgcttggattgtactatactatattatct 42879459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University