View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_low_34 (Length: 294)
Name: NF11218_low_34
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 25 - 243
Target Start/End: Complemental strand, 48807438 - 48807222
Alignment:
| Q |
25 |
ctcactgctggcagctactaaggtaaactcgaacctttttctattgggtacaagtgaaccaaaaccattactcaattactatattattgaatatatataa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48807438 |
ctcactgctggcagctactaaggtaaactcgaacctttttctattgggtacaagtgaaccaaaaccattactcaattactatattattgaatatata--a |
48807341 |
T |
|
| Q |
125 |
tagcttatgttacttgataaggtttattttttgtctatcatgatgtatatgtattagattagataattacaatcatatcatattacatgaaaagttgttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48807340 |
tagcttatgttacttgataaggtttattttttgtctatcatgatgtatatgtattagattagataattacaatcatatcatattacatgaaaagttgttg |
48807241 |
T |
|
| Q |
225 |
gtttgtttggtaccgtgat |
243 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
48807240 |
gtttgtttggtactgtgat |
48807222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University