View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_low_35 (Length: 282)
Name: NF11218_low_35
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_low_35 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 27909 - 28188
Alignment:
| Q |
1 |
gtaaacatttgcaaacgctatcatcgtcattacagctagcaaagtttccacaagcattatatgttaaacatttgcttcttggctgcttccatataactgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27909 |
gtaaacatttgcaaacgctatcatcgtcattacagctagcaaagtttccacaagcattatatgttaaacatttgcttcttggctgcttccatataactag |
28008 |
T |
 |
| Q |
101 |
caaatcatcttccacccactgtatcacacctgtcgaattgaggaacaatcttttattgttatactgttcgttacgaattactgatctgttccgtttttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28009 |
caaatcatcttccacccactgtatcacacctgtggaattgaggaacaatcttttattgttatactgttcgttacgaattactgatctgttccgtttttca |
28108 |
T |
 |
| Q |
201 |
ggtgaactgaatttgtt--------------caagaaaactgaagttggtcaacaaattataaacctcaaagctgatgtc |
266 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28109 |
ggtgaactgaatttgtttgacgaattataaacaagaaaactgaagttggtcaacaaattataaacctcaaagctgatgtc |
28188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University