View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_low_37 (Length: 269)
Name: NF11218_low_37
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 37653437 - 37653219
Alignment:
| Q |
6 |
agtagtcgaagtttcctagcaatatagatggttacctttaacatctttacctaggtttgtggattttcttttacatgtaaattggaaactatactcacta |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37653437 |
agtagtcgaagtttcctagcaatatagatggttacctttaacatctttacctaggtttgtggattttcttttacatgtaaattggaaactatactcactc |
37653338 |
T |
 |
| Q |
106 |
aggtgatgatttgaactttgatgttatagttatcattatgatctttatgcgactgttatgttaatgatgtggatgttggtcttgatctgattagcatcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37653337 |
aggtgatgatttgaactttgatgttatagttatcattatgatctttatgcgactgttatggtaatgatgtggatgttggtcttgatctga-tagcatcaa |
37653239 |
T |
 |
| Q |
206 |
cattgacataattttaaaaa |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37653238 |
cattgacataattttaaaaa |
37653219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University