View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_low_42 (Length: 250)
Name: NF11218_low_42
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 89 - 232
Target Start/End: Original strand, 36982199 - 36982342
Alignment:
| Q |
89 |
atgggttaggacaggttgcaactttgacactaatggcaatggaaatgcctaactggtggttgtggaacaaacataaactgtacagtacctggaaatcctc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36982199 |
atgggttaggacaggttgcaactttgacactaatggcaatggaaatgcctaactggtggttgtggaacaaacataaactgtacagtacctggaaatcctc |
36982298 |
T |
 |
| Q |
189 |
ctgcaacaatttccgattttacccttggtgaacctgatttttat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36982299 |
ctgcaacaatttccgattttacccttggtgaacctgatttttat |
36982342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University