View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_low_45 (Length: 242)
Name: NF11218_low_45
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 1792704 - 1792495
Alignment:
| Q |
16 |
agagaatcaagggggtgaagcacaaggagttatttgtgttttgcacattctttgagccaagggttttgtcattgccacgtttacccatgttttcctctaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792704 |
agagaatcaagggggtgaagcacaaggagttatttgtgttttgcacattctttgaaccaagggttttgtcattgccacgtttacccatgttttcctctaa |
1792605 |
T |
|
| Q |
116 |
atttgacaacgattaagaaagtcccaagaataaaagac-nnnnnnngtgtgattcaatgatatctttatcattttcgtacttaagtgttatgcaaatttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792604 |
atttgacaacgattaagaaagtcccaagaataaaagacaaaaaaaagtgtgattcaatgatatctttatcattttcgtacttaagtgttatgcaaatttg |
1792505 |
T |
|
| Q |
215 |
tataagcttc |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
1792504 |
tataagcttc |
1792495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University