View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11218_low_49 (Length: 225)

Name: NF11218_low_49
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11218_low_49
NF11218_low_49
[»] chr3 (1 HSPs)
chr3 (15-206)||(13012985-13013176)
[»] chr8 (1 HSPs)
chr8 (15-203)||(11532313-11532501)
[»] chr4 (2 HSPs)
chr4 (50-125)||(49616731-49616806)
chr4 (79-194)||(49617380-49617495)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 13012985 - 13013176
Alignment:
15 cacagatggaataaaaataggcaaatcaaacgggataactattaaaagtgcgaacatcggcaccggtgatgattgcattgcaatgatatctggtactagg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| | ||||||||||||    
13012985 cacagatggaataaaaataggcaaatcaaacgggataactattaaaagtgcgagcatcggcaccggtgatgattgtattgcaatggtctctggtactagg 13013084  T
115 aatgtttggatctctgacgtttcttgtggtcctggacatggagttagtattggaagtcttggaaagaatgatggagaagaagatgttgacaa 206  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13013085 aatgtttggatctctgacgttttttgtggtcctggacatggagttagtattggaagtcttggaaagaatgatggagaagaagatgttgacaa 13013176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 11532313 - 11532501
Alignment:
15 cacagatggaataaaaataggcaaatcaaacgggataactattaaaagtgcgaacatcggcaccggtgatgattgcattgcaatgatatctggtactagg 114  Q
    ||||||||| || |||||||| |  ||||| || |||| ||||  ||||| |||||| || ||||| |||||||||||||| ||| | || |||||||||    
11532313 cacagatggtattaaaatagggatgtcaaagggaataaatatttcaagtgtgaacattggaaccggcgatgattgcattgctatgctctcaggtactagg 11532412  T
115 aatgtttggatctctgacgtttcttgtggtcctggacatggagttagtattggaagtcttggaaagaatgatggagaagaagatgttga 203  Q
    |||||| | || || || |||| |||||||||||| |||||| ||||| | |||||||||||   |||||| || ||||||||| ||||    
11532413 aatgttcgaatttcagatgttttttgtggtcctggtcatggaattagtgtcggaagtcttggtgggaatgaaggtgaagaagatattga 11532501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 125
Target Start/End: Original strand, 49616731 - 49616806
Alignment:
50 taactattaaaagtgcgaacatcggcaccggtgatgattgcattgcaatgatatctggtactaggaatgtttggat 125  Q
    ||||||| | ||||| |||||| |  || ||||||||||||||||| ||||| ||||||||| ||||||| |||||    
49616731 taactatcacaagtgtgaacattgcaactggtgatgattgcattgctatgatctctggtactgggaatgtatggat 49616806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 79 - 194
Target Start/End: Complemental strand, 49617495 - 49617380
Alignment:
79 ggtgatgattgcattgcaatgatatctggtactaggaatgtttggatctctgacgtttcttgtggtcctggacatggagttagtattggaagtcttggaa 178  Q
    |||||||| |||||||| ||||| ||| |||||| |||||||||||| ||  | |||  |||||||| ||| |||||| |  || ||| ||| ||||| |    
49617495 ggtgatgactgcattgctatgatctctagtactaagaatgtttggatttcatatgttctttgtggtcttggtcatggaatcggtgttgaaagccttggta 49617396  T
179 agaatgatggagaaga 194  Q
    |||||||||| |||||    
49617395 agaatgatggggaaga 49617380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University