View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11218_low_50 (Length: 221)
Name: NF11218_low_50
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11218_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 4675148 - 4674959
Alignment:
| Q |
19 |
acacgcacacaatttcagattttgctcatttatttcaattaaaatgtatttaacttaagcaatgaggttatgtcacataacatgtcgtgcgggttgtgtg |
118 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4675148 |
acacacacacaatttcagattttgcttatttatttcaattaaaatgtatttaacttaagcaatgaggttatgtcacataacatgtcgtgcgagttgtgtg |
4675049 |
T |
|
| Q |
119 |
gtgaatattgtcctgcacaatagcgcttctcnnnnnnnaaaaattggcatagcgtcgttgtatgatatgttgataattatcaatctgtgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4675048 |
gtgaatattgtcctgcacaatagcgcttctcttttttaaaaaattggcatagcgtcgttgtatgatatgttgataattatcgatctgtgc |
4674959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 73 - 149
Target Start/End: Original strand, 6800694 - 6800770
Alignment:
| Q |
73 |
ttaagcaatgaggttatgtcacataacatgtcgtgcgggttgtgtggtgaatattgtcctgcacaatagcgcttctc |
149 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
6800694 |
ttaagcaatgaggttatgccaaataacatgtcgtgcgggttgtgtggtgaatattgtcgtgcacaataacacttctc |
6800770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 70
Target Start/End: Original strand, 6800580 - 6800624
Alignment:
| Q |
26 |
cacaatttcagattttgctcatttatttcaattaaaatgtattta |
70 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
6800580 |
cacaatttcagatcttattcatttatttcaattaaaatttattta |
6800624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 44 - 138
Target Start/End: Complemental strand, 43900085 - 43899996
Alignment:
| Q |
44 |
tcatttatttcaattaaaatgtatttaacttaagcaatgaggttatgtcacataacatgtcgtgcgggttgtgtggtgaatattgtcctgcacaa |
138 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||| |||||||| ||||||||| | ||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
43900085 |
tcatttatttcaattaaaatctatttaa-----gcaataaggttatgctacataacatattatgcgggtcgtgcggtgaatattgtcatgcacaa |
43899996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 149
Target Start/End: Complemental strand, 5384039 - 5383962
Alignment:
| Q |
73 |
ttaagcaatgaggttatgtcacataacatgtcgtgcggg-ttgtgtggtgaatattgtcctgcacaatagcgcttctc |
149 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| || ||| ||| ||||||||||||||| ||||||||| | |||||| |
|
|
| T |
5384039 |
ttaagcaacaaggttatgccacataacatgtcttgtggggttgcgtggtgaatattgtcgtgcacaataacacttctc |
5383962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 149
Target Start/End: Complemental strand, 5408898 - 5408858
Alignment:
| Q |
109 |
gggttgtgtggtgaatattgtcctgcacaatagcgcttctc |
149 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
5408898 |
gggttgcgtggtgaatattgtcgtgcacaatagcacttctc |
5408858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University