View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11219_high_10 (Length: 286)
Name: NF11219_high_10
Description: NF11219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11219_high_10 |
 |  |
|
| [»] scaffold0062 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 262
Target Start/End: Original strand, 40572835 - 40573093
Alignment:
| Q |
4 |
tttgatgcttcaaaattatgtcatgttctctctcatagtctattttatttccttcttctattatttcttcggtctaatatatttttaatttctcaatgtg |
103 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
40572835 |
tttgatgcttcaaaaatatgtcatgtcctctctcatagtctattttatttccttcttctattatttcttcagtctaatatatttttaacttctcaatgtg |
40572934 |
T |
 |
| Q |
104 |
gcgaaaaactgaggattttgaaaaaataacttggaacaaacaggatattgtttgcttgaataaggagtttggaggtttggggataaggataattaaagaa |
203 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| ||||| ||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40572935 |
gcgaaaaagtgaggatttttaaaaaataacttggatcaaacgggacattgtttgcttgaataagtagtttggaggttttgggataaggataattaaagaa |
40573034 |
T |
 |
| Q |
204 |
tttaatgtggctcctctaggtaaatggtgttggaggttgagggggaaaagataatggtt |
262 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
40573035 |
tttaatgtggctcttctaggtaaatgatgttggaggttgagggagaaaagataatggtt |
40573093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 240
Target Start/End: Original strand, 17858180 - 17858260
Alignment:
| Q |
160 |
tgaataaggagtttggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggt |
240 |
Q |
| |
|
||||||||||| |||| ||||||||| | |||| ||| ||||||||||| | |||| ||| | ||||||||||||||||| |
|
|
| T |
17858180 |
tgaataaggaggttggtggtttgggggttaggagaataaaagaatttaacatagctcttcttgctaaatggtgttggaggt |
17858260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 160 - 240
Target Start/End: Original strand, 41691185 - 41691265
Alignment:
| Q |
160 |
tgaataaggagtttggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggt |
240 |
Q |
| |
|
||||||||| | |||| ||||||||| |||||| | ||||||||||| | |||| ||| ||||||||||||||||||| |
|
|
| T |
41691185 |
tgaataagggggttggtggtttgggggtaaggagtctacaagaatttaatattgctcttctgggtaaatggtgttggaggt |
41691265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 154 - 246
Target Start/End: Original strand, 36212633 - 36212724
Alignment:
| Q |
154 |
tttgcttgaataaggagtttggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggttgaggg |
246 |
Q |
| |
|
|||| ||||| |||||| |||| ||||||| | | | || ||||||||||||||||||||||| | | ||| ||||||||||||||||||||| |
|
|
| T |
36212633 |
tttgtttgaaaaaggaggttggtggtttggaggttaagagaattaaagaatttaatgtggctcttttcggt-aatggtgttggaggttgaggg |
36212724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 246
Target Start/End: Original strand, 6695570 - 6695622
Alignment:
| Q |
194 |
aattaaagaatttaatgtggctcctctaggtaaatggtgttggaggttgaggg |
246 |
Q |
| |
|
||||| ||||||||||||||||| | | || | |||||||||||||||||||| |
|
|
| T |
6695570 |
aattagagaatttaatgtggctcatttgggaatatggtgttggaggttgaggg |
6695622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 240
Target Start/End: Complemental strand, 7447476 - 7447396
Alignment:
| Q |
160 |
tgaataaggagtttggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggt |
240 |
Q |
| |
|
||||||||||| |||| ||||||||| | |||| ||| ||||||||||| | |||| ||| | ||||||||||||||||| |
|
|
| T |
7447476 |
tgaataaggaggttggtggtttgggggttaggagaataaaagaatttaacattgctcttcttgctaaatggtgttggaggt |
7447396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 2540678 - 2540587
Alignment:
| Q |
151 |
ttgtttgcttgaataaggagtttggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggttg |
242 |
Q |
| |
|
||||||| || | ||||||| |||| |||||||||||||||| ||||| |||||||||| |||| |||| || ||||||||||||||| |
|
|
| T |
2540678 |
ttgtttgtttaagtaaggaggttggtggtttggggataaggagaattagagaatttaataatgctctattaggaaagtggtgttggaggttg |
2540587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 29; Significance: 0.0000004; HSPs: 3)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 242
Target Start/End: Original strand, 16921 - 16989
Alignment:
| Q |
174 |
ggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggttg |
242 |
Q |
| |
|
||||||||||| | |||| ||| | |||||||||| |||| | |||||||||||||||||||| |||| |
|
|
| T |
16921 |
ggaggtttgggagtgaggagaatgagagaatttaatttggcccttctaggtaaatggtgttggaagttg |
16989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 242
Target Start/End: Original strand, 27089 - 27157
Alignment:
| Q |
174 |
ggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggttg |
242 |
Q |
| |
|
||||||||||| | |||| ||| | |||||||||| |||| | |||||||||||||||||||| |||| |
|
|
| T |
27089 |
ggaggtttgggagtgaggagaatgagagaatttaatttggcccttctaggtaaatggtgttggaagttg |
27157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 242
Target Start/End: Original strand, 37255 - 37323
Alignment:
| Q |
174 |
ggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggttg |
242 |
Q |
| |
|
||||||||||| | |||| ||| | |||||||||| |||| | |||||||||||||||||||| |||| |
|
|
| T |
37255 |
ggaggtttgggagtgaggagaatgagagaatttaatttggcccttctaggtaaatggtgttggaagttg |
37323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 173
Target Start/End: Complemental strand, 3654347 - 3654287
Alignment:
| Q |
113 |
tgaggattttgaaaaaataacttggaacaaacaggatattgtttgcttgaataaggagttt |
173 |
Q |
| |
|
||||||||| ||||||||||||||| |||| ||| | | |||||||||||||||||||| |
|
|
| T |
3654347 |
tgaggatttcaaaaaaataacttggatcaaatgggacactatttgcttgaataaggagttt |
3654287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 160 - 240
Target Start/End: Complemental strand, 48434865 - 48434785
Alignment:
| Q |
160 |
tgaataaggagtttggaggtttggggataaggataattaaagaatttaatgtggctcctctaggtaaatggtgttggaggt |
240 |
Q |
| |
|
||||||||||| |||| ||||||||| | ||| ||| ||||||||||| | |||| ||| | ||||||||||||||||| |
|
|
| T |
48434865 |
tgaataaggaggttggtggtttgggggttcggagaataaaagaatttaacttagctcttcttgctaaatggtgttggaggt |
48434785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University