View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11219_high_14 (Length: 239)
Name: NF11219_high_14
Description: NF11219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11219_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 14726068 - 14726284
Alignment:
| Q |
20 |
catgtgattttgtccatgttatcgtgaggaaattgtctatacaatgtaat-------------aattgtatttgtaacttgtaaggcnnnnnnnagaaat |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||| |
|
|
| T |
14726068 |
catgtgattttgtccatgttttcgtgaggaaattgtctatacaatgtaatgtagttttgtgctaattgtatttgtaacttgtaaagctttttttagaaat |
14726167 |
T |
|
| Q |
107 |
gtgtttcgaaccnnnnnnnngttactatcgaacctttctagtagggtggtctgaaagtgttattagatgctagacagcatttggttatgcagccatgtcg |
206 |
Q |
| |
|
||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14726168 |
gtgtttcaaaccttttttttgttaccatcgaacctttctagtagggtggtctgaaagtgttattagatgctagagagcatttggttatgcagccatgtcg |
14726267 |
T |
|
| Q |
207 |
gtttgctggttggaggt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14726268 |
gtttgctggttggaggt |
14726284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University