View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11219_high_17 (Length: 227)
Name: NF11219_high_17
Description: NF11219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11219_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 43537802 - 43537605
Alignment:
| Q |
19 |
gaaatcactcatcaagtcatatttcaaatccactattgcaaacaaaacaaattatttgacatctttatcttgatgcatgtacacatgcaaagccacaaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43537802 |
gaaatcactcatcaagtcatatttcaaatccaccattgcaaacaaaccaaattacttgacatctttatcttgatgcatgtacacatgcaaagtcacaaag |
43537703 |
T |
|
| Q |
119 |
ttgttgaacatggttacaaacattactcggaagagcacaaggaatatcaaaacaattcaaaattgcattgtagatactccccaaaactttcatctcac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43537702 |
ttgttgaacatggttacaaacattactcggaagagcacaaggaatatcaaaacaattcaaaattgcattgtagatactccccaaaactttcatttcac |
43537605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University