View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11219_low_15 (Length: 239)
Name: NF11219_low_15
Description: NF11219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11219_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 23527882 - 23527672
Alignment:
| Q |
18 |
ttttataggtagtgtccattgtagcaaaataaaatctctgaccttttgtgctgccaaaataatagatgattaaagtaggcagaagcatcagtactataac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23527882 |
ttttataggtagtgtccattgtagcaaaataaaatctctgaccttttgtgctgccaaaataatagatgattaaagtaggcagaagcatcagtactataac |
23527783 |
T |
 |
| Q |
118 |
tatcagtctattattgttaaggagagaacatgtcctctctctttccttagagaaggaatctccaactcaccacaaaactaacacacttaagatatctctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23527782 |
tatcagtctattattgttaaggagagaacatgtcctctctctttcctaagagaaggaatctccaactcaccacaaaactaacacacttaagatatctctt |
23527683 |
T |
 |
| Q |
218 |
tctatctctct |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
23527682 |
tctatctctct |
23527672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University