View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1121_high_27 (Length: 313)

Name: NF1121_high_27
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1121_high_27
NF1121_high_27
[»] scaffold0038 (1 HSPs)
scaffold0038 (28-116)||(47423-47511)
[»] chr6 (2 HSPs)
chr6 (28-116)||(28247261-28247349)
chr6 (1-96)||(28192198-28192291)


Alignment Details
Target: scaffold0038 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 47511 - 47423
Alignment:
28 ttgctattcctcgacgattgagtgcaaaaatatagtattatagaattatacttgtcatttctatggttatcccccattggtgttgtgta 116  Q
    ||||||| |||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
47511 ttgctatccctcgaagattgagtggaaaaatgtagtattatagaattatacttgtcatttctatggttagcccccattggtgttgtgta 47423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 28247349 - 28247261
Alignment:
28 ttgctattcctcgacgattgagtgcaaaaatatagtattatagaattatacttgtcatttctatggttatcccccattggtgttgtgta 116  Q
    ||||||| |||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
28247349 ttgctatccctcgaagattgagtggaaaaatgtagtattatagaattatacttgtcatttctatggttagcccccattggtgttgtgta 28247261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 28192198 - 28192291
Alignment:
1 tctgaattatagttttcattacatacattgctattcctcgacgattgagtgcaaaaatatagtattatagaattatacttgtcatttctatggtta 96  Q
    |||||||||||||||||||||||||||||||||| ||| |||||||||||  |||||| |||||| ||||  |  |||||||||| ||||||||||    
28192198 tctgaattatagttttcattacatacattgctatcccttgacgattgagtagaaaaatgtagtatgatag--tgttacttgtcatctctatggtta 28192291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University