View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_high_29 (Length: 306)
Name: NF1121_high_29
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 53 - 238
Target Start/End: Complemental strand, 9378908 - 9378705
Alignment:
| Q |
53 |
tatgtttcttcttctcctgcttctgctgaataactactatattggctatattccatgttttctaattcaaacatcatgtgaaggagaggaatgttttttg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9378908 |
tatgtttcttcttctcctgcttctgctgaataactactatattggctatattccatgttttctaattcaaacatcatgtgaaggagaggaatgttttttg |
9378809 |
T |
 |
| Q |
153 |
aggtagagagtgtgtttgtgttt------------------gtgtctttgccttgtgatgatatgcatgtatctatatatattggctttaagttatttga |
234 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9378808 |
aggtagagagtgtgtttgtgtttgtgtttgtgtttgtgtttgtgtctttgccttgtgatgatatgcatgtatctatatatattggctttaagttatttga |
9378709 |
T |
 |
| Q |
235 |
gttc |
238 |
Q |
| |
|
|||| |
|
|
| T |
9378708 |
gttc |
9378705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University