View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_high_3 (Length: 649)
Name: NF1121_high_3
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_high_3 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold1318 (1 HSPs) |
 |  |  |
|
| [»] scaffold0392 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0692 (1 HSPs) |
 |  |  |
|
| [»] scaffold0570 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0491 (2 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0245 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold1259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 532; Significance: 0; HSPs: 145)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 532; E-Value: 0
Query Start/End: Original strand, 29 - 640
Target Start/End: Complemental strand, 24779153 - 24778542
Alignment:
| Q |
29 |
aattctttgtgggattgagttaattgattgaatctttagtttctgtttgattttagtttgaaacctatataagggtctttttaatgggtttagtgttgaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24779153 |
aattctttgtgggattgagttaattgattgaatctttagtttctgtttgattttagtttgaaacctatataagggtctttttaatgggtttagtgttgaa |
24779054 |
T |
 |
| Q |
129 |
atatcacgtctgat--ttattttcttgatattggagtagtttttcttatttctcatttgtaaaaatgttcttgtaactgttctttaagattttagaagct |
226 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24779053 |
atatcacgtctgatatttattttcttgatattggagtagtttttcttatttctcatttgtaaaaatgttcttgtaactgttctttaagattttagaagct |
24778954 |
T |
 |
| Q |
227 |
tgtatgctgagcagggannnnnnnngctaaagaatgggtttttgttgcatgcttaactgatatatgatttgaattttagggattaatgtttaattcttta |
326 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24778953 |
tgtatgctgagcagggattttttttgctaaagaatgggtttttgttgcatgcttaactgatatatgatttgaattttagggattaatgtttaattcttta |
24778854 |
T |
 |
| Q |
327 |
atatttgtatgtgccctgttttgagatattataatcttgcatgtggattatggaacatatgttcttttttatgaacgttttcannnnnnnngcatgctta |
426 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
24778853 |
atatttgtatgtgccctgtt--gagatattataatcttgcatgtggattatggaacatatgttcttttttatgatcgttttcattttttttgcatgctta |
24778756 |
T |
 |
| Q |
427 |
actggtctagagcttggtgcttaatgttgtatcgcttatgacttattagttagccattgtagttcatattgtttgatagaaaattatggtgtaatttgat |
526 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24778755 |
actggtctagagcttggtgcttaatgttgtatcgcttatgacttattagttagccattgtagttcatattgtttgatagaacattatggtgtaatttgat |
24778656 |
T |
 |
| Q |
527 |
ccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttccatatgttatttggcgcatgcttgactggtatagttaatcaatttcag |
626 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24778655 |
ccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttccatatgttatttggcgcatgcttgactggtatagttaatcaatttcag |
24778556 |
T |
 |
| Q |
627 |
ggttttagtattat |
640 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
24778555 |
ggttttagtgttat |
24778542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 501 - 576
Target Start/End: Original strand, 15296117 - 15296192
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15296117 |
gatagaacattatggtgtaatttgatccatgtggccgaccccacttagtgggataaggcttggttgttgttgtagt |
15296192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 31566236 - 31566160
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31566236 |
tttgatagaacactatggtgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
31566160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 40991640 - 40991713
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
40991640 |
tgatagaacattatggtgtaatttgatccatgtagctgaccccacttagtgagataagacttggctgttgttgt |
40991713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 48508444 - 48508517
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48508444 |
tgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
48508517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 5169039 - 5169114
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5169039 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
5169114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 12096778 - 12096705
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12096778 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
12096705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 42510089 - 42510016
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| ||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
42510089 |
tgattgaacattatggcgtaatttgatccatgtagccgaccccacttagagggaaaaggcttggctgttgttgt |
42510016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 46148237 - 46148310
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
46148237 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggtcaaggcttggttgttgttgt |
46148310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 54128588 - 54128661
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54128588 |
tgatagaacattatggcataatttgatccatgtaggcgaccccacttagtgggataaggcttggttgttgttgt |
54128661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 501 - 573
Target Start/End: Complemental strand, 45374549 - 45374477
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45374549 |
gatagaacattatggcgtaatttaatccatgtagctgaccccacttagtgggataaggcttggttgttgttgt |
45374477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 49503632 - 49503568
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
49503632 |
attatggcgtaatttgatccatgtagccgaccctacttagtgggataaggcttggttgttgttgt |
49503568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 311384 - 311309
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
311384 |
tttgatagaacactatggcgtcatttgatacatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
311309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 511 - 570
Target Start/End: Original strand, 41529981 - 41530040
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41529981 |
tatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgt |
41530040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 507 - 574
Target Start/End: Complemental strand, 52882728 - 52882661
Alignment:
| Q |
507 |
aaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
52882728 |
aaattatggcgtaatttgatccatgtagccaaccccacttagtgggagaaggcttggttgttgttgta |
52882661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 53262348 - 53262423
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53262348 |
tttgatagaacactatggcgtcatttgatctatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
53262423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 566
Target Start/End: Original strand, 19758096 - 19758161
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctg |
566 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19758096 |
tgatagaacattatggtataatttgatccatgtagc-gaccccacttagtgggataaggcttggctg |
19758161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 31146919 - 31146981
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
31146919 |
tatggtgtaatttgatccatgtagccgactccacttagtgggataaggctcggttgttgttgt |
31146981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 48734220 - 48734146
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48734220 |
tgatagaacattatggcgtaagttgatccatgtagctgaccccacttagtgggataaggcttgattgttgttgta |
48734146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 7895953 - 7895880
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
7895953 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttaatgggataaggcttggttgttgttgt |
7895880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 501 - 562
Target Start/End: Complemental strand, 24541404 - 24541343
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24541404 |
gatagaacattatggcgtaatttgatccatgtacccgaccccacttagtgggataaggcttg |
24541343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 29601101 - 29601174
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||| ||||||||||||||||||| ||||||| | ||||||| |
|
|
| T |
29601101 |
tgatagaacattatgatgtaatttgatccatgtagctgaccccacttagtgggatacggcttggttcttgttgt |
29601174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 37083365 - 37083292
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| ||||||| |||||||| ||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37083365 |
tgatcgaacattatggcgtaatttggtccttgtagccgaccccacttagtgggataaggcttggttgttgttgt |
37083292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 45486922 - 45486849
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
45486922 |
tgatagaacattatggcataatttgatccatgtagccggccccacttagtgggataaagcttggttgttgttgt |
45486849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 47555405 - 47555332
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47555405 |
tgatagaacactatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgt |
47555332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 49042146 - 49042219
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
49042146 |
tgatagaacactatggcgtaatttgatccatgtagccgaccccacttggtgagataaggcttggttgttgttgt |
49042219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 52139029 - 52139082
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52139029 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
52139082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 504 - 569
Target Start/End: Complemental strand, 52927917 - 52927852
Alignment:
| Q |
504 |
agaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52927917 |
agaacattatggcataatttgatccatgtagccgaccccacttagtgggataaggcttggttgttg |
52927852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 47233671 - 47233595
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | ||||| || ||||||| |||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
47233671 |
tttgatagaacactatggcgtcatttgattcatgtagccgaccccagttagtgggataaggcttggttgttgttgta |
47233595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 509 - 569
Target Start/End: Complemental strand, 50960701 - 50960641
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
50960701 |
attatggtgtaatttgatccatttagccaaccccacttagtgggataaggcttggttgttg |
50960641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 22279 - 22354
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||| |||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
22279 |
tttgatagaacactatggcgtcatttgatctatgtagccgaccccacttagtgggataaagcttggttgttgttgt |
22354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 501 - 572
Target Start/End: Complemental strand, 21862813 - 21862742
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||| | |||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
21862813 |
gatagaagaatatggtgtcatttgatccatgtagccgaccccacttagtgagataaggcttgcttgttgttg |
21862742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 31454300 - 31454225
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || ||||||| ||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31454300 |
tttgatagaacactatggcgtcatttgattcatttagccgaccccacttagtgggataaggcttggttgttgttgt |
31454225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 40273280 - 40273205
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
40273280 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggtttggttgttgttgt |
40273205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 53519787 - 53519862
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | |||| || ||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
53519787 |
tttgatagaacactatgacgtcatttgatccatgtagccgaccccacttagtgagataaggcttggttgttgttgt |
53519862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 566
Target Start/End: Original strand, 19737193 - 19737258
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctg |
566 |
Q |
| |
|
||||| || |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19737193 |
tgataaaacattatggtataatttgatccatgtagc-gaccccacttagtgggataaggcttggctg |
19737258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 30797895 - 30797821
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| |||||| ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
30797895 |
tgatagaacattatgacgtaatttgatctatgtaaccgaccccacttagtggaataaggcttggttgttgttgta |
30797821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 45289164 - 45289090
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45289164 |
tgatagaacattatagcataatttgatccatgtcgccaaccccacttagtgggataaggcttggttgttgttgta |
45289090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 45834662 - 45834600
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45834662 |
tatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgt |
45834600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 48532166 - 48532240
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatcca-tgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48532166 |
tgatagaacactatggcgtcatttgatccaatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
48532240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 54365048 - 54364975
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
54365048 |
tgatagaacactatgacgtaatttgatccatgtagccgaccacact-agtgggataaggcttggctgttgttgta |
54364975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 2133685 - 2133612
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2133685 |
tgatagaacactatggcgtgatttgatccatgtactcgaccccacttagtgggataaggcttggttgttgttgt |
2133612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 19676154 - 19676081
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| || |||||||||||||||| ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
19676154 |
tgatagagcattatggcgtgatttgatccatgtagctgaccccacttagtgggataaggcttggttgttattgt |
19676081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 512 - 573
Target Start/End: Original strand, 38060935 - 38060996
Alignment:
| Q |
512 |
atggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
38060935 |
atggcgtaatttgatccatgtagccgaccccacttagtgggataagaattggttgttgttgt |
38060996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 52156157 - 52156084
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || || |||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52156157 |
tgatagaacactatggcgtcatctgatccatgtagccgaccccacttagtgggataaggctcggttgttgttgt |
52156084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 344836 - 344772
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||| ||||||||||||| ||||||||| |
|
|
| T |
344836 |
attatggtgtaatttcatcgatgtagccgacccaacttagtaggataaggcttggttgttgttgt |
344772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 498 - 574
Target Start/End: Original strand, 35033353 - 35033429
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | ||||| || ||||||||||||||||||||| || |||||||||||||||||| |||||||||| |
|
|
| T |
35033353 |
tttgatagaacactatggcgttatttgatccatgtagccgacctcatctagtgggataaggcttggttgttgttgta |
35033429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 525 - 573
Target Start/End: Original strand, 39512777 - 39512825
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39512777 |
atccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
39512825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 39781982 - 39781918
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
39781982 |
attatggcgtaatttgatcaatgtggccgaccccactcagtgggataaggcttgggtgttgttgt |
39781918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 25191584 - 25191659
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||| || ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
25191584 |
tttgatagaacactatggcgtcatttgatccatgtagctgatcccacttagtgggataatgcttggttgttgttgt |
25191659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 510 - 573
Target Start/End: Complemental strand, 37102871 - 37102808
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||| || ||||||||| |
|
|
| T |
37102871 |
ttatggtgtaatttgatccatgtagcctaccccacttcgtgggataaggcatgtttgttgttgt |
37102808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 40116411 - 40116348
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
40116411 |
tgatagaacattatggcgtaatttgatccacgtagccgacctcgcttagtgggataaggcttgg |
40116348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 521 - 571
Target Start/End: Original strand, 659755 - 659805
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
659755 |
tttgatccatgtagccgaccccacttagtggggtaaggcttggttgttgtt |
659805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 520 - 574
Target Start/End: Original strand, 7278693 - 7278747
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
7278693 |
atttgatccatgtagccgaccccacttagtgggataaagcttagttgttgttgta |
7278747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 14415332 - 14415259
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||| || ||||||| |||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
14415332 |
tgatataacattatggcataatttgatc-atgtagccgaccccacttagtgggataagacttggttgttgttgta |
14415259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 40106693 - 40106619
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| |||||| |||||||||| |||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40106693 |
tgatagaacattatgacataatttgatcaatgtagtggaccccacttagtgggataaggcttggttgttgttgta |
40106619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 388335 - 388262
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
388335 |
tgatagagcattatgacgtaatttgatcaatgtagccaaccccacttagtgggataaggcttggttgtcgttgt |
388262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 561
Target Start/End: Complemental strand, 34844646 - 34844585
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34844646 |
tgatagaacattatggtataatatgatccatgtagccgaccccactaagtaggataaggctt |
34844585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 39208817 - 39208890
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| ||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
39208817 |
tgatagaacattatgacgtaatttgatccatgtagaggaccccagttagtgggatatggcttggttgttgttgt |
39208890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 51447790 - 51447717
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||| |||||||||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
51447790 |
tgatagaacactatggcgtcatttgattcatgtagccggccccatttagtgggataaggcttggttgttgttgt |
51447717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 517 - 574
Target Start/End: Complemental strand, 53214927 - 53214870
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
53214927 |
gtaatttgatccatgcagccgaccccatttagtcggataaggcttggttgttgttgta |
53214870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 518 - 570
Target Start/End: Original strand, 32170632 - 32170684
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
32170632 |
taatttgatccatgtagccgaccccacttagtgagataaagcttggttgttgt |
32170684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 35420479 - 35420550
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| |||||||| |||||||||| ||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
35420479 |
gatagaacattatggcgtaatttggtccatgtagc-gaccccatttagtgggataaggcttggttgttattgt |
35420550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 50249607 - 50249659
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
50249607 |
tttgatccatgtagtcgaccccacttagtgggatacggcttggttgttgttgt |
50249659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 517 - 576
Target Start/End: Complemental strand, 6780719 - 6780660
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| || |||| ||||||||||||||||| |
|
|
| T |
6780719 |
gtaatttgatccctgtagccgaccacacttagtgagaaaaggtttggctgttgttgtagt |
6780660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 29475895 - 29475969
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||| ||||| || ||| |||||||||||||| |||| |||||||||| |
|
|
| T |
29475895 |
tgatagaaaactatggcgtaatttgacccatctagccaactccagttagtgggataaggtttggttgttgttgta |
29475969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 517 - 571
Target Start/End: Original strand, 35481154 - 35481208
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
35481154 |
gtaatttgattcatttagccgaccccacttaatgggataaggcttggttgttgtt |
35481208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 36304175 - 36304249
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| | ||||||| ||||||||||||||||||||||||||||| | || || |||||| || |||||||||| |
|
|
| T |
36304175 |
tgataggacattatggcgtaatttgatccatgtagccgaccccactcaatgtgacaaggctcggttgttgttgta |
36304249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 38850330 - 38850404
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||||||||||||||||||| |||||| ||| | |||||||||| |
|
|
| T |
38850330 |
tgatagaacactatgacgtaatttgatccatgtagccgaccccacttagtaggataaaacttagttgttgttgta |
38850404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 501 - 563
Target Start/End: Complemental strand, 39600753 - 39600691
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||| |||||||||||||||||||||| || || ||||||||| |||||||||| ||||| |
|
|
| T |
39600753 |
gatagaacattatggtgtaatttgatccatctaaccaaccccactttgtgggataagacttgg |
39600691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 509 - 563
Target Start/End: Complemental strand, 40672431 - 40672377
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||| |||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
40672431 |
attatggcataatttgatccatgtagctgacctcacttagtgggataaggcttgg |
40672377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 517 - 571
Target Start/End: Original strand, 49888413 - 49888467
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |||| ||||||| |
|
|
| T |
49888413 |
gtaatttgatccatgtagccgaccccacttagttggaaaaggtttggttgttgtt |
49888467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 561
Target Start/End: Complemental strand, 17022745 - 17022684
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||| |||||||||| |||| || ||||||||||||| || ||||||||||||||||| |
|
|
| T |
17022745 |
tgatagaatattatggtgtcatttaattcatgtagccgacctcatttagtgggataaggctt |
17022684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 498 - 563
Target Start/End: Original strand, 20208205 - 20208270
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
20208205 |
tttgatagaactttatggcatcatttgatccatgtagccgaccccatttagtgggataacgcttgg |
20208270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 534 - 575
Target Start/End: Original strand, 27192466 - 27192507
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27192466 |
gccgaccccacttagtgggataaggcttggttgttgttgtag |
27192507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 30332633 - 30332560
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||| | |||| ||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
30332633 |
tgatagaacattatggcataatttgatccaggcagcctaccccacctagtgggatacggcttggttgttgttgt |
30332560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 498 - 563
Target Start/End: Complemental strand, 41842598 - 41842533
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| | ||| || |||||| | |||||||||| |
|
|
| T |
41842598 |
tttgatagaacattatggtgtaatttgatccatgtagtcaacctcatttagtgagctaaggcttgg |
41842533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 500 - 568
Target Start/End: Complemental strand, 23534643 - 23534576
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||| ||||| || ||||||||||||| |||| |
|
|
| T |
23534643 |
tgatagaacattatggcgtaatttgatccatgtagtcgacctcactttgt-ggataaggcttggttgtt |
23534576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 527 - 571
Target Start/End: Complemental strand, 44103002 - 44102958
Alignment:
| Q |
527 |
ccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
44103002 |
ccatgtagccgaccccacttagtaggataaggcttggttgttgtt |
44102958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 502 - 573
Target Start/End: Complemental strand, 4472458 - 4472387
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | |||||||||| |||||||||||||||||| |||||||| ||||| |||||| ||||||||| |
|
|
| T |
4472458 |
atagaacactatggtgtaacttgatccatgtagccgactacacttagttcgataaagcttggttgttgttgt |
4472387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 519 - 574
Target Start/End: Original strand, 34253688 - 34253743
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | ||||||| ||||| |||| |
|
|
| T |
34253688 |
aatttgatccatgtagccgaccccatttagtgggacagggcttggttgttgctgta |
34253743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 528 - 563
Target Start/End: Complemental strand, 35032811 - 35032776
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35032811 |
catgtagccgaccccacttagtgggataaggcttgg |
35032776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 521 - 568
Target Start/End: Complemental strand, 46431731 - 46431684
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
46431731 |
tttgatccatgtcgccaaccccacttagtgggataaggcttggttgtt |
46431684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 534 - 573
Target Start/End: Original strand, 48259947 - 48259986
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48259947 |
gccgaccccacttagtgggataaggcttggttgttgttgt |
48259986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 519 - 570
Target Start/End: Original strand, 49045063 - 49045114
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
49045063 |
aatttaatccatgtagccgaccccactcagtgggacaaggcttggttgttgt |
49045114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 563
Target Start/End: Original strand, 53266900 - 53266963
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| | ||||||||| ||||||| |||| |
|
|
| T |
53266900 |
tgatagaatgttatggtgtaatttaatccatgtagccgatctcacttagtgagataagggttgg |
53266963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 2340790 - 2340716
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| || ||||||||||| |||| |||||||||||| | |||||| |||| |||||||||| |
|
|
| T |
2340790 |
tgatagaacattatggcgttgtttgatccatgaagccaaccccacttagttgtataaggattggttgttgttgta |
2340716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 575
Target Start/End: Original strand, 11284218 - 11284272
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
11284218 |
tttgatccatgtagccaaccccgcttagtgagataaggcttgcttgttgttgtag |
11284272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 502 - 572
Target Start/End: Complemental strand, 21428065 - 21427995
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| |||| ||| ||| |||||||||| |||| ||||||| |
|
|
| T |
21428065 |
atagaacattatggcgtaatttgatccatgtagtcgactccatttattgggataaggattggtagttgttg |
21427995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 520 - 562
Target Start/End: Original strand, 28245666 - 28245708
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
28245666 |
atttgatccatgtagccgatcccacttagtgagataaggcttg |
28245708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 571
Target Start/End: Complemental strand, 31453013 - 31452963
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31453013 |
tttgattcatgtagcagaccccacttagtggaataaggcttggttgttgtt |
31452963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 535 - 573
Target Start/End: Original strand, 35701093 - 35701131
Alignment:
| Q |
535 |
ccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35701093 |
ccgaccccacttagtgggataaggcttggttgttgttgt |
35701131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 49841825 - 49841895
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||||||| ||| | | |||||||||| |||||| |
|
|
| T |
49841825 |
tgatagaacattatggcataatttgatccatgtagctgaccccacatagcgaggtaaggcttggttgttgt |
49841895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 562
Target Start/End: Original strand, 53951964 - 53952026
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||| |||| |||| |||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
53951964 |
tgatagaatattacggtgccgtttgatccatatagccgaccccacatagtgggataaggcttg |
53952026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 530 - 563
Target Start/End: Complemental strand, 944501 - 944468
Alignment:
| Q |
530 |
tgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
944501 |
tgtagccgaccccacttagtgggataaggcttgg |
944468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 528 - 569
Target Start/End: Original strand, 8566670 - 8566711
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
8566670 |
catgtagccgaccccacttagtgggataaagcttggttgttg |
8566711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 570
Target Start/End: Original strand, 26990442 - 26990491
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
26990442 |
tttgattcacgtagccgaccccacttagtgagataaggcttggttgttgt |
26990491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 35465758 - 35465811
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||||| |||| ||||||||| |
|
|
| T |
35465758 |
atttgatccatgtagctgacctcacttaatgggataaggattggttgttgttgt |
35465811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 533 - 574
Target Start/End: Complemental strand, 43396122 - 43396081
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
43396122 |
agccgaccccacttagtgggataaagcttggttgttgttgta |
43396081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 501 - 570
Target Start/End: Original strand, 46140617 - 46140686
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||| ||||||| || |||||||||||||| ||||||||||| ||| ||||||| |||| |||||| |
|
|
| T |
46140617 |
gatagaacattatggagttgtttgatccatgtagtcgaccccactttgtgagataaggtttggttgttgt |
46140686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 47249365 - 47249292
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||| |||| | ||||||| ||||||| |||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
47249365 |
tgatagaacattttggtattgtttgatcaatgtagcagaccccacttagtgtgatgaggcttggcggttgttgt |
47249292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 533 - 573
Target Start/End: Complemental strand, 237336 - 237296
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
237336 |
agccgaccccacttaatgggataaggcttggttgttgttgt |
237296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 517 - 556
Target Start/End: Original strand, 1512050 - 1512090
Alignment:
| Q |
517 |
gtaatttgatccatgtagccga-ccccacttagtgggataa |
556 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1512050 |
gtaatttgatccatgtagccgacccccacttagtgggataa |
1512090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 3987564 - 3987616
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||| |||||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
3987564 |
tttgattcatgtacccgaccccactttgtgggataagacttggttgttgttgt |
3987616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 501 - 561
Target Start/End: Original strand, 7942864 - 7942924
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||| |||||||||| || ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7942864 |
gatagaacattatggtgttgttcgatccatgtagtcgataccacttagtgggataaggctt |
7942924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 533 - 573
Target Start/End: Complemental strand, 23610972 - 23610932
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23610972 |
agccggccccacttagtgggataaggcttggttgttgttgt |
23610932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 561
Target Start/End: Original strand, 27893319 - 27893359
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
27893319 |
tttgattcatgtagccgatcccacttagtgggataaggctt |
27893359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 522 - 574
Target Start/End: Original strand, 33307350 - 33307402
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| | ||||||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
33307350 |
ttgatcaacgtagccgactccacttcgtgggataagacttggctgttgttgta |
33307402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 508 - 556
Target Start/End: Original strand, 34610464 - 34610512
Alignment:
| Q |
508 |
aattatggtgtaatttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34610464 |
aattatgacgtaatttgattcatttagccgaccccacttagtgggataa |
34610512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 522 - 574
Target Start/End: Original strand, 40122645 - 40122697
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| ||| |||||| |
|
|
| T |
40122645 |
ttgatccatgtagccgaccccacttagttggataaaacttggttgtcgttgta |
40122697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 508 - 572
Target Start/End: Original strand, 45468792 - 45468856
Alignment:
| Q |
508 |
aattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| || ||||||| ||||| |||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
45468792 |
aattatggcgtcgtttgatctatgtaaccgatcccacttagtggaataaggcttggttgttgttg |
45468856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 49933492 - 49933440
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
49933492 |
tttggtccatgtagccgacctcacttagtgggataaagcttgattgttgttgt |
49933440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 533 - 576
Target Start/End: Original strand, 30305256 - 30305299
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
30305256 |
agccgaccccacttaatgtgataaggcttggttgttgttgtagt |
30305299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 500 - 575
Target Start/End: Complemental strand, 42026609 - 42026534
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||| ||||||| || ||||||| ||| ||||||||||||| || || |||||| ||||| | ||||||||| |
|
|
| T |
42026609 |
tgatagaacattatggcgttatttgattcatttagccgaccccacatactgtgataagacttggttcttgttgtag |
42026534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 522 - 573
Target Start/End: Original strand, 43308793 - 43308844
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| |||||||| | ||||||| |
|
|
| T |
43308793 |
ttgatccatgtagccaaccccactttgtgggatgaggcttggtttttgttgt |
43308844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 517 - 563
Target Start/End: Original strand, 3186972 - 3187018
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||| || |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3186972 |
gtaatttaattcatgtagccgactccacttagtaggataaggcttgg |
3187018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 573
Target Start/End: Original strand, 7446273 - 7446327
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| |||||| || || |||||| |
|
|
| T |
7446273 |
aatttgatccatgtagctgactccacttagtgggaaaaggctcggttgctgttgt |
7446327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 573
Target Start/End: Original strand, 7454415 - 7454469
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| |||||| || || |||||| |
|
|
| T |
7454415 |
aatttgatccatgtagctgactccacttagtgggaaaaggctcggttgctgttgt |
7454469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 527 - 573
Target Start/End: Complemental strand, 24084368 - 24084322
Alignment:
| Q |
527 |
ccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| |||| ||||||||| |
|
|
| T |
24084368 |
ccatgtaaccgactccacttagtgggataaggtttggttgttgttgt |
24084322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 502 - 572
Target Start/End: Original strand, 26490526 - 26490596
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||| ||| |||||||||| |||||| |||| |||||||| |
|
|
| T |
26490526 |
atagaatattatggcgtaatttgatccatatagtcgatcccacttagtaagataagacttgattgttgttg |
26490596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 529 - 563
Target Start/End: Complemental strand, 37103026 - 37102992
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
37103026 |
atgtagccgaccccacttagtgggataaggtttgg |
37102992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 517 - 563
Target Start/End: Original strand, 38431079 - 38431125
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||| |||||||| |
|
|
| T |
38431079 |
gtaatttgatccatgtagtcgaccccactaagtaggatgaggcttgg |
38431125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 532 - 574
Target Start/End: Original strand, 41965819 - 41965861
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||||| |
|
|
| T |
41965819 |
tagccgactccacttaatgggataaggcttggttgttgttgta |
41965861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 539 - 573
Target Start/End: Original strand, 43529294 - 43529328
Alignment:
| Q |
539 |
ccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43529294 |
ccccacttagtgggataaggcttggttgttgttgt |
43529328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 46367460 - 46367390
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| |||||| || |||||||||||||||| |||||||||| | |||||| |||||| |||||| |
|
|
| T |
46367460 |
tgatagaacattatgacgtcgtttgatccatgtagcctaccccacttaattggataaagcttggttgttgt |
46367390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 520 - 574
Target Start/End: Complemental strand, 48712128 - 48712074
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||| |||||| |||||||||| |
|
|
| T |
48712128 |
atttcatccatgtagttgatcccacttagtgggataatgcttggttgttgttgta |
48712074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 7120792 - 7120865
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||| |||||||||||||| || |||| ||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
7120792 |
tgataaaatattatgacgtaatttgatccatataaccgataccacttagtgggatatggcctggttgttgttgt |
7120865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 557
Target Start/End: Complemental strand, 27796053 - 27795996
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||| ||||||| ||||||||||| ||||| || |||||||||| | ||||||| |
|
|
| T |
27796053 |
tgatagaacattatggcgtaatttgatctatgtacccaaccccacttattaggataag |
27795996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 501 - 562
Target Start/End: Original strand, 29919484 - 29919545
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||| ||||||| ||||||||||| || ||||| |
|
|
| T |
29919484 |
gatagaatattatggcataatttgatcaatgtaaccgaccctacttagtgggacaaagcttg |
29919545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 501 - 562
Target Start/End: Complemental strand, 29928366 - 29928305
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||| ||||||| |||||||||| || || ||||||||||||||||||| || ||||| |
|
|
| T |
29928366 |
gatagaatattatggcataatttgatcaatataaccgaccccacttagtgggacaaagcttg |
29928305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 501 - 562
Target Start/End: Original strand, 29968637 - 29968698
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||| ||||||| ||||||||||| || ||||| |
|
|
| T |
29968637 |
gatagaatattatggcataatttgatcaatgtaaccgaccctacttagtgggacaaagcttg |
29968698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 501 - 562
Target Start/End: Complemental strand, 29977520 - 29977459
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||| ||||||| |||||||||| || || ||||||||||||||||||| || ||||| |
|
|
| T |
29977520 |
gatagaatattatggcataatttgatcaatataaccgaccccacttagtgggacaaagcttg |
29977459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 492 - 569
Target Start/End: Complemental strand, 33755425 - 33755348
Alignment:
| Q |
492 |
atattgtttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||| |||||| ||| |||||| ||||||||||| |||||||| ||||||||||||| |||| |||| || ||||| |
|
|
| T |
33755425 |
atatggtttgagtgaacattatgacgtaatttgatcgatgtagccaaccccacttagtgagatagggctcggttgttg |
33755348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 39535473 - 39535401
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||| ||| |||||||||||||| || ||| ||||||||| |
|
|
| T |
39535473 |
tgatagaacattatggtggcgtttgatccatgtaaccggccc-acttagtgggataaagcatggttgttgttgt |
39535401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 43694824 - 43694771
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||| |||||||||||| ||| || ||||||||| |
|
|
| T |
43694824 |
atttgatctatgtagtcgaccccatttagtgggataaagctgggttgttgttgt |
43694771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 525 - 570
Target Start/End: Complemental strand, 45493740 - 45493695
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||||||||||||||||||| |||||| || ||| |||||| |
|
|
| T |
45493740 |
atccatgtagccgaccccacttagtaggataaagcgtggttgttgt |
45493695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 49090632 - 49090673
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
49090632 |
tagccgaccccacttaatgggaaaaggcttggttgttgttgt |
49090673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 529 - 573
Target Start/End: Complemental strand, 4660211 - 4660167
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
4660211 |
atgtagccgactccaattagtggaataaggcttggttgttgttgt |
4660167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 509 - 561
Target Start/End: Original strand, 6988120 - 6988172
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||| || |||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
6988120 |
attatggcgtcatttgatcaatgtagccgactccttttagtgggataaggctt |
6988172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 557
Target Start/End: Complemental strand, 32350191 - 32350155
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
32350191 |
tttgatccatgtagccgacccaacttagtgagataag |
32350155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 529 - 573
Target Start/End: Original strand, 34067137 - 34067181
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
34067137 |
atgtagccaaccccacgtagtggaataaggcttggttgttgttgt |
34067181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 517 - 568
Target Start/End: Complemental strand, 36049358 - 36049309
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
36049358 |
gtaatttgat--atgtagccggccccacttagtgggatagggcttggttgtt |
36049309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 37534259 - 37534203
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||||||| | ||||| ||||||||| |
|
|
| T |
37534259 |
gtaatttgatctatgtagctgacccttcttagtgggatatgacttggttgttgttgt |
37534203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 50631933 - 50631881
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
50631933 |
tttgattcatgcagccaaccccacttagtgggataaagattggttgttgttgt |
50631881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 500 - 569
Target Start/End: Original strand, 55244487 - 55244560
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgacc----ccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||| |||| || |||||||||||||| ||||||||||| |
|
|
| T |
55244487 |
tgatagaacattatggtgtcgtttgatccatgaagctgaccaaccccgcttagtgggataagacttggctgttg |
55244560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 70; Significance: 3e-31; HSPs: 127)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 500 - 577
Target Start/End: Original strand, 45419444 - 45419521
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagtt |
577 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45419444 |
tgatagaacattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgtagtt |
45419521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 501 - 573
Target Start/End: Complemental strand, 1928659 - 1928587
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1928659 |
gatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
1928587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 490544 - 490617
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
490544 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttgtttgttgttgt |
490617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 14742157 - 14742082
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14742157 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
14742082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 500 - 583
Target Start/End: Original strand, 29520858 - 29520941
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttccatat |
583 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||| |||||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
29520858 |
tgatagaacattatggcgtaatttgatccatgtagcccaccccatttagtgggataatgcttggttgttgttgtagttctatat |
29520941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 11523796 - 11523723
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11523796 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
11523723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 30198339 - 30198266
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30198339 |
tgatagaatattatggtgtagtttgatctatgttgccgaccccacttagtgggataaggcttggttgttgttgt |
30198266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 510 - 573
Target Start/End: Complemental strand, 39651091 - 39651028
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39651091 |
ttatggtgtaatttgatccatatacccgaccccacttagtgggataaggcttggttgttgttgt |
39651028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 520 - 575
Target Start/End: Original strand, 44529454 - 44529509
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44529454 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgtag |
44529509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 35914674 - 35914600
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||||||| |||||| ||||| |||||||||| |
|
|
| T |
35914674 |
tgatagaacattatggcgtaatttgatccatgtagctgaccccacttagtgagataagacttggttgttgttgta |
35914600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 2216495 - 2216568
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
2216495 |
tgatagaacattatagtgtaatttgatccatgtagccgaccccactcagtgagataaggcttggtggttgttgt |
2216568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 25473456 - 25473403
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25473456 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
25473403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 27556375 - 27556302
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
27556375 |
tgatagaacattatggcataatttgatccatgtagccgaccccacttagtgggttaaagcttggttgttgttgt |
27556302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 32276894 - 32276967
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
32276894 |
tgatagaacattatggcgtaatttgatccatgtagacgaacccacttagtgggataaagcttggttgttgttgt |
32276967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 36545378 - 36545431
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36545378 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
36545431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 36565314 - 36565241
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
36565314 |
tgatagaacactatggcgttatttgatccatgtagccgaccccacttagtgggataaggctcggttgttgttgt |
36565241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 35323999 - 35324055
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35323999 |
gtaatttgatccacgtagccgaccccacttagtgggataaggcttggttgttgttgt |
35324055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 35362723 - 35362651
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||| |||||||||||||||| ||||||||| |||||||| |
|
|
| T |
35362723 |
tgatagaacattatggcgtaatttgatccatgcagccaaccccacttagtgggaaaaggcttggttgttgttg |
35362651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 509 - 569
Target Start/End: Complemental strand, 45041380 - 45041320
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
45041380 |
attatggcgtaatttgatccatgtagctgaccccacttagtgggataaggcttggttgttg |
45041320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 41031475 - 41031420
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41031475 |
taatttgatccatatagccgaccccacttagtgggataaggcttggttgttgttgt |
41031420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 41031581 - 41031526
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41031581 |
taatttgatccatatagccgaccccacttagtgggataaggcttggttgttgttgt |
41031526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 42469802 - 42469727
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
42469802 |
tttgatagaacactatggcgtcatttgatccatgtagctgaccccacttattgggataaggcttggttgttgttgt |
42469727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 12491211 - 12491141
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
12491211 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttagttgttgt |
12491141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 14459104 - 14459177
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccga-ccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||||| |
|
|
| T |
14459104 |
tgatggaacattatggtgtaatttgatccatgtagccgacccccactttgtgggataagccttggttgttgttg |
14459177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 21121355 - 21121427
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
21121355 |
tgatagaacactatggcgtaatttgatc-atgtagccgaccccacttagtgggaaaaggcttggttgttgttgt |
21121427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 23492243 - 23492316
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||||||| |||| |||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
23492243 |
tgatagaacactatggtgtcatttaatccatgtagccgaccccacttagtgagataaggcttgtttgttgttgt |
23492316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 569
Target Start/End: Original strand, 32931169 - 32931238
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
32931169 |
tgatagaacattatggcataatttgatccatgtagccgaccccacttagtgggaaaagccttggttgttg |
32931238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 35647003 - 35646930
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
35647003 |
tgatagaacattatggcgtaatttgatccatgcagccgaccccacttagtgtaacaaggcttggttgttgttgt |
35646930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 44047585 - 44047532
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44047585 |
atttgatccatgtagctgaccccacttagtgggataaggcttggttgttgttgt |
44047532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 510 - 574
Target Start/End: Original strand, 12611716 - 12611780
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
12611716 |
ttatggtgtcgtttgatccatgtagccgatcccaattagtgggataaggcttggttgttgttgta |
12611780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 513 - 573
Target Start/End: Complemental strand, 43350791 - 43350731
Alignment:
| Q |
513 |
tggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
43350791 |
tggtgtaatttgatccaagtagccgaccccgctaagtgggataaggcttggttgttgttgt |
43350731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 526 - 573
Target Start/End: Original strand, 1064955 - 1065002
Alignment:
| Q |
526 |
tccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1064955 |
tccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
1065002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 515 - 574
Target Start/End: Original strand, 26363710 - 26363769
Alignment:
| Q |
515 |
gtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
26363710 |
gtgtaatttgatccatgtagtcgaccccactcagtgggataagacttggttgttgttgta |
26363769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 500 - 563
Target Start/End: Original strand, 30689944 - 30690007
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||| || |||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30689944 |
tgatataacattatgacgtaatttgatccatgtagccgaccccacttagtgggataatgcttgg |
30690007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 30812891 - 30812816
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | |||||||| |||||| |||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
30812891 |
tttgatagaacactatggtgtcgtttgattcatgtagccgaccccacttagtgggaaaaggcttggtggttgttgt |
30812816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 521 - 572
Target Start/End: Complemental strand, 36395000 - 36394949
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
36395000 |
tttgatccatgtagccgaccccacttagtgggataaggcttcgttgttgttg |
36394949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 1313773 - 1313843
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
1313773 |
tgatagaacattatggcgtaattttatccatgtagttgaccccacttagtgggataatgcttggttgttgt |
1313843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 508 - 574
Target Start/End: Original strand, 9695802 - 9695868
Alignment:
| Q |
508 |
aattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
9695802 |
aattatggtggattttgatccatgtaaccgaccccgcttagtgggataaggcttgattgttgttgta |
9695868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 523 - 573
Target Start/End: Complemental strand, 15215462 - 15215412
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
15215462 |
tgatccatgtagccgaccccacttagtaggataaggcttggttgttgttgt |
15215412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 44699675 - 44699745
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| | ||||| |||||||||||| |||||| ||||||||||||||||| ||||||||| |||||| |
|
|
| T |
44699675 |
tgatagaacactatggcgtaatttgatccctgtagcagaccccacttagtgggaaaaggcttggttgttgt |
44699745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 3473779 - 3473852
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| ||||||| | ||||| |||||| |||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
3473779 |
tgattgaatattatggcgaaatttaatccatttagccgaccccacttagtgggataaggctttgttgttgttgt |
3473852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 10668550 - 10668497
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
10668550 |
atttgatcgatgtagccgacctcacttagtgggataaggcttggttgttgttgt |
10668497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 502 - 563
Target Start/End: Original strand, 18741843 - 18741904
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
18741843 |
atagaacattatgacgtaatttgatccaagtagccgaccccacttagtgggataagacttgg |
18741904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 502 - 563
Target Start/End: Original strand, 18746807 - 18746868
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
18746807 |
atagaacattatgacgtaatttgatccaagtagccgaccccacttagtgggataagacttgg |
18746868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 549
Target Start/End: Original strand, 29700485 - 29700534
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagt |
549 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29700485 |
tgatagaacattatggtgtaatttgatccatgtagccgactccacttagt |
29700534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 498 - 558
Target Start/End: Original strand, 2796760 - 2796820
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataagg |
558 |
Q |
| |
|
|||||||||| | ||||| |||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2796760 |
tttgatagaacagtatggcgtaatttgattcatgtagacgaccccacttagtgggataagg |
2796820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 569
Target Start/End: Original strand, 26055651 - 26055699
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
26055651 |
tttgatccatgtagccgatcccacttagtgggataaggcttggttgttg |
26055699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 35643660 - 35643608
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
35643660 |
tttgatccatgtagcctaccccacttagtgggataatgcttggttgttgttgt |
35643608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 39953316 - 39953264
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
39953316 |
tttgattcatgtagccgaccccacttagtgggataagacttggttgttgttgt |
39953264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 41212070 - 41212145
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgta--gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| || |||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
41212070 |
tgatagaacattatggcgtaatttgatccatctatagccgaccccacttagtgggaaaatgcttggttgttgttgt |
41212145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 509 - 569
Target Start/End: Complemental strand, 45512508 - 45512448
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
45512508 |
attatggcataatttgatccatgtagcctaccccacttagtgggatgaggcttggttgttg |
45512448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 522 - 573
Target Start/End: Complemental strand, 4558259 - 4558208
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4558259 |
ttgatacatgtagccaaccccacttagtgggataaggcttggttgttgttgt |
4558208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 10824264 - 10824189
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| |||||| |||| ||||||||||||||||||||| | |||| ||| ||||||||| ||||||||| |
|
|
| T |
10824264 |
tttgatagaacattatgaagtaagttgatccatgtagccgaccccgcctagtcggaaaaggcttggttgttgttgt |
10824189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 31716030 - 31716104
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagc--cgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| | | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
31716030 |
gatagaacattatggcgtaatttgatccatgtagcgtcaccaccacttagtgggataaggcttggttgttgttgt |
31716104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 40982951 - 40982896
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
40982951 |
taatttgatccatgttgccgaccccatttagtgggaaaaggcttggttgttgttgt |
40982896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 42854079 - 42854004
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| || | ||||| || |||||||||||||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
42854079 |
tttgatataacactatggcgtcatttgatccatgtagccgaccccatttagtgggataaggtttggtggttgttgt |
42854004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 521 - 563
Target Start/End: Complemental strand, 14742890 - 14742848
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14742890 |
tttgatccatgtagccaaccccacttagtgggataaggcttgg |
14742848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 532 - 574
Target Start/End: Complemental strand, 27449224 - 27449182
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27449224 |
tagccgaccccacttagtgggataaagcttggctgttgttgta |
27449182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 30559902 - 30559980
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgt-----agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
30559902 |
tgatagaacattatgacgtaatttgatccatgtaatgtagccgaccccagttagtgggataaggcttggttgttgttgt |
30559980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 503 - 573
Target Start/End: Complemental strand, 39967569 - 39967499
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||| |||||||| || ||||| |||||| ||||||||| |
|
|
| T |
39967569 |
tagaacattatggcgtagtttgatccatgtagccgatcccacttattgtgataatgcttggttgttgttgt |
39967499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 525 - 574
Target Start/End: Original strand, 4061897 - 4061946
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
4061897 |
atccatgtagccgaccccacttagtggaaaaaggcttggttgttgttgta |
4061946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 498 - 571
Target Start/End: Complemental strand, 7531719 - 7531646
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||| | |||||||| |||||| ||||||||||| | |||||||| ||||||||||||| ||||||| |
|
|
| T |
7531719 |
tttgatagaacactatggtgtcgtttgattcatgtagccgaactcacttagtaggataaggcttggttgttgtt |
7531646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 8255595 - 8255531
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccga--ccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||||||||||||||||||||| | |||||||||||||||| |||||| ||||||||| |
|
|
| T |
8255595 |
tatggcgtaatttgatccatgtagccgagacaccacttagtgggataaagcttggttgttgttgt |
8255531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 524 - 573
Target Start/End: Complemental strand, 35085186 - 35085137
Alignment:
| Q |
524 |
gatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || | ||||||||| |
|
|
| T |
35085186 |
gatccatgtagccgaccccacttagtgggataagggttagttgttgttgt |
35085137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 42584568 - 42584640
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| ||||||||||| |||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
42584568 |
tgatagaacattatgacgtaatttgatct-tgtagccgaccccacttagtgggataagacttgattgttgttgt |
42584640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 515 - 555
Target Start/End: Original strand, 1335550 - 1335590
Alignment:
| Q |
515 |
gtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1335550 |
gtgtaatttgattcatgtagccgaccccacttagtgggata |
1335590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 12985916 - 12985972
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| |||||| |||| |||| |||||||||||||| ||||||||| |
|
|
| T |
12985916 |
gtaatttgatccatgaagccgagcccatttagcgggataaggcttggttgttgttgt |
12985972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 31309583 - 31309635
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31309583 |
tttgattcatgtagccgacaccacttagtgggataagacttggttgttgttgt |
31309635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 36143550 - 36143622
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||||||||||| |||| ||| ||||||||| |||||||| |
|
|
| T |
36143550 |
tgatagaacattatgacgtcatctgatccatgtagccgaccccacctagtcggaaaaggcttggttgttgttg |
36143622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 37077975 - 37078031
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
37077975 |
gtaatttgatccatgcagccgaccccacttaatgggataaaacttggttgttgttgt |
37078031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 2518471 - 2518400
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |||||| ||||||||||||| ||||||| |||| ||||||| |
|
|
| T |
2518471 |
tgatagaacattatggcataatttgatccttgtagctgaccccacttagtaagataaggtttggttgttgtt |
2518400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 521 - 572
Target Start/End: Complemental strand, 18474024 - 18473973
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| ||||| |||||||| |
|
|
| T |
18474024 |
tttgattcatgtagccgacaccacttagtgggataagacttggttgttgttg |
18473973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 534 - 573
Target Start/End: Original strand, 24837934 - 24837973
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24837934 |
gccgaccccacttagtgggataaggcttggttgttgttgt |
24837973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 490 - 573
Target Start/End: Complemental strand, 32569793 - 32569710
Alignment:
| Q |
490 |
tcatattgtttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||| |||||||| | |||| || ||||||| ||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
32569793 |
tcatagtgtatgatagaacactatgacgtcatttgatttatgtagccgaccccatttagtgggataagacttggttgttgttgt |
32569710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 39388993 - 39389068
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||| ||||||| || |||||||||||| ||| ||||||||||||||||||| |||||| | ||||||| |
|
|
| T |
39388993 |
tttggtagaagattatggcgtcgtttgatccatgtggccaaccccacttagtgggataaagcttggtttttgttgt |
39389068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 498 - 569
Target Start/End: Original strand, 39702161 - 39702232
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||| |||||||| | |||||||| |||||||||||| || |||||||||||| ||||| ||||| |
|
|
| T |
39702161 |
tttgatagaacattatggtatcatttgatctatgtagccgaccacatttagtgggataaaacttggttgttg |
39702232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 563
Target Start/End: Original strand, 16917412 - 16917454
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
16917412 |
tttgatccatgtagccgtccccacttagtgggataagacttgg |
16917454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 523 - 573
Target Start/End: Original strand, 16921451 - 16921501
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
16921451 |
tgatccatgtagccgaccgtacttagtgggataaagcttggttgttgttgt |
16921501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 517 - 575
Target Start/End: Original strand, 25439529 - 25439587
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
25439529 |
gtaatttgatctatgtaactaaccccacttagtgggatatggcttggttgttgttgtag |
25439587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 509 - 555
Target Start/End: Complemental strand, 37808261 - 37808215
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| ||||||||||| |
|
|
| T |
37808261 |
attatggtgtagtttgattcatgtagccgaccccatttagtgggata |
37808215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 574
Target Start/End: Complemental strand, 3638387 - 3638334
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||| |||||| ||| ||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
3638387 |
tttgttccatggagctgaccccacttagtgggataaggcttggttgatgttgta |
3638334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 9842361 - 9842402
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
9842361 |
tagccgaccccacttagtggcataaggcttggttgttgttgt |
9842402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 14903770 - 14903843
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | ||||||| ||||||||||||||||||| ||||||||||||||| || ||||| ||||||||| |
|
|
| T |
14903770 |
tgataggacattatggcgtaatttgatccatgtagcttaccccacttagtggggaaaaacttggttgttgttgt |
14903843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 503 - 556
Target Start/End: Complemental strand, 16035797 - 16035744
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
||||| |||||| |||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
16035797 |
tagaacattatgacgtaatttgattcatgtagctgaccccacttagtgggataa |
16035744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 574
Target Start/End: Complemental strand, 16971824 - 16971771
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||| | |||||||||| |
|
|
| T |
16971824 |
tttgatccatgtagccgacccaatttagtgggattaggcttcgttgttgttgta |
16971771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 21425255 - 21425328
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| ||||| ||||||||| ||| ||||||| | ||||||| |
|
|
| T |
21425255 |
tgatagaccattatggcataatttgatccatgtagcagaccctacttagtggaatatggcttggttattgttgt |
21425328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 28169601 - 28169673
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||||||||||| |||||| || || |||||||||||| ||||||||||||| || |||||| |
|
|
| T |
28169601 |
tgataaaatattatggtgtaattttatccatataaccaaccccacttagt-ggataaggcttggttgatgttgt |
28169673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 32978115 - 32978156
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
32978115 |
tagccgacccaacttagtgggataaggcttggttgttgttgt |
32978156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 40813553 - 40813606
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
40813553 |
atttgatccatgtagccaaccccacttagtgggataaaacttcgttgttgttgt |
40813606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 525 - 574
Target Start/End: Original strand, 44456991 - 44457040
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| |||| |||||||||| |
|
|
| T |
44456991 |
atccatgtagctggccccacttagtgggataaggtttggatgttgttgta |
44457040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 1549443 - 1549391
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
1549443 |
tttgatccatgtaacggaccccacttagtgggatatggcttggtggttgttgt |
1549391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 8879502 - 8879446
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| | |||||| |||||| ||||||||| |
|
|
| T |
8879502 |
gtaatttaatccatgtagccgactccacttattaggataaagcttggttgttgttgt |
8879446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 498 - 570
Target Start/End: Original strand, 8932910 - 8932982
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||| || | ||||| || |||||||||||||||| |||||||||||||| |||| |||||| |||||| |
|
|
| T |
8932910 |
tttgataaaacactatggcgtcatttgatccatgtagctgaccccacttagtgaaataaagcttggttgttgt |
8932982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 533 - 573
Target Start/End: Complemental strand, 16918536 - 16918496
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16918536 |
agccaaccccacttagtgggataaggcttggttgttgttgt |
16918496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 30783094 - 30783042
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
30783094 |
tttgatccatgtagccgaccccatctagtgggataaaacttgactgttgttgt |
30783042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 501 - 573
Target Start/End: Complemental strand, 35320472 - 35320400
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| |||||| || ||||||| |||||||||||||||||||| |||||| | ||||||| |
|
|
| T |
35320472 |
gatagaacattatggcttaatttaattaatgtagctgaccccacttagtgggataaagcttggttattgttgt |
35320400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 500 - 540
Target Start/End: Complemental strand, 43904738 - 43904698
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgacc |
540 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
43904738 |
tgatagaacattatggcgtaatttgatccatgtagccgacc |
43904698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 532 - 574
Target Start/End: Original strand, 14744522 - 14744565
Alignment:
| Q |
532 |
tagccgaccccactt-agtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14744522 |
tagccgaccccactttagtgggataaggcttggttgttgttgta |
14744565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 510 - 557
Target Start/End: Complemental strand, 28254412 - 28254365
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
28254412 |
ttatggtgtaatttgatccatgtagcagaccctacacagtgggataag |
28254365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 502 - 557
Target Start/End: Original strand, 33076335 - 33076390
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33076335 |
atagaatattatgatgtaatttgatccatgtagttatccccacttagtgggataag |
33076390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 528 - 563
Target Start/End: Original strand, 43733443 - 43733478
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43733443 |
catgtagccgatcccacttagtgggataaggcttgg |
43733478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 539 - 573
Target Start/End: Original strand, 2027778 - 2027812
Alignment:
| Q |
539 |
ccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2027778 |
ccccacttagtgggataaggcttggttgttgttgt |
2027812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 532 - 574
Target Start/End: Original strand, 2938334 - 2938376
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
2938334 |
tagcctaccccacttagtgggttaaggcttggttgttgttgta |
2938376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 529 - 571
Target Start/End: Original strand, 5205413 - 5205455
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
5205413 |
atgtaggcgaccccacttagtgggataagacttggttgttgtt |
5205455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 496 - 562
Target Start/End: Original strand, 6483500 - 6483566
Alignment:
| Q |
496 |
tgtttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||| ||||||| ||||| | || ||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
6483500 |
tgttcgatagaatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
6483566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 563
Target Start/End: Original strand, 16351607 - 16351649
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
16351607 |
tttgattcatgtagacgaccccacttagtggaataaggcttgg |
16351649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 518 - 572
Target Start/End: Original strand, 25288991 - 25289045
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||| || |||| |||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
25288991 |
taatttgatctatttagctgaccccacctagtggtataaggcttggttgttgttg |
25289045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 532 - 574
Target Start/End: Original strand, 30980058 - 30980100
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
30980058 |
tagccgatcccacttagtgggatgaggcttggttgttgttgta |
30980100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 511 - 572
Target Start/End: Original strand, 3802093 - 3802154
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||| |||||||||| |||||| ||| |||| ||||||||||||||||| | |||||||| |
|
|
| T |
3802093 |
tatggagtaatttgattaatgtagtcgaacccatttagtgggataaggctttgttgttgttg |
3802154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 561
Target Start/End: Complemental strand, 5127375 - 5127314
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||| |||| || ||||||||| ||||||| | ||||||||| |||||||||||||| |
|
|
| T |
5127375 |
tgatagaacattacggcgtaatttgacccatgtaactaaccccacttggtgggataaggctt |
5127314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 524 - 573
Target Start/End: Complemental strand, 5810327 - 5810278
Alignment:
| Q |
524 |
gatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| ||| |||||| |||||| |||||||| ||||||||| |
|
|
| T |
5810327 |
gatccatgtagccaacctcacttaatgggatgaggcttggttgttgttgt |
5810278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 569
Target Start/End: Original strand, 12026009 - 12026058
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| |||||| |||| ||||| |
|
|
| T |
12026009 |
atttgatccatgtaaccgaccctacttagtggaataaggtttggttgttg |
12026058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 536 - 573
Target Start/End: Complemental strand, 16008432 - 16008395
Alignment:
| Q |
536 |
cgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
16008432 |
cgaccccacttagtgggataagacttggttgttgttgt |
16008395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 18125381 - 18125453
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||||||| ||||||| |||||| | |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
18125381 |
tgatagaatactatggtgta-tttgatcaatgtagtcaacccgacttagtgggataaaacttggttgttgttgt |
18125453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 537 - 574
Target Start/End: Complemental strand, 32838927 - 32838890
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
32838927 |
gaccccacttagtgggataagacttggttgttgttgta |
32838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 38901872 - 38901819
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
38901872 |
atttgattcatgtagcggaccccatatagtgggataaggcttgattgttgttgt |
38901819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 529 - 561
Target Start/End: Original strand, 4011484 - 4011516
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
4011484 |
atgtagccgaccccactaagtgggataaggctt |
4011516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 518 - 562
Target Start/End: Complemental strand, 18742078 - 18742034
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||| |||||| |
|
|
| T |
18742078 |
taatttgatcaatgtagtcgaccccaattagtgggatatggcttg |
18742034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 518 - 562
Target Start/End: Complemental strand, 18747042 - 18746998
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||| |||||| |
|
|
| T |
18747042 |
taatttgatcaatgtagtcgaccccaattagtgggatatggcttg |
18746998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 501 - 541
Target Start/End: Original strand, 24558693 - 24558733
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccc |
541 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
24558693 |
gatagaacattatgacgtaatttgatccatgtagccgaccc |
24558733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 500 - 568
Target Start/End: Original strand, 26639235 - 26639303
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| ||||||| |||||||| |||| | ||||| |||| |
|
|
| T |
26639235 |
tgatagatcattatggtgtcgtttgatccatgtatccgacccaacttagtgagatatgacttggttgtt |
26639303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 30748681 - 30748745
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||||||||| || ||| |||| ||| | ||||||||| |
|
|
| T |
30748681 |
attatgatgtcatttgatccatgtagctgaccccactaagcgggttaagacttagttgttgttgt |
30748745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 537 - 573
Target Start/End: Original strand, 32043833 - 32043869
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32043833 |
gaccccacttagtgggataaggcttgattgttgttgt |
32043869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 36069811 - 36069883
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| |||| || |||||||||||||| ||||| | |||||||| ||| |||| ||||| |||||||| |
|
|
| T |
36069811 |
tgatagaacattacggcgtaatttgatccatatagccaaacccacttactggaataatgcttgattgttgttg |
36069883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 529 - 561
Target Start/End: Original strand, 39049825 - 39049857
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
39049825 |
atgtagccgaccccacttagtgggataaagctt |
39049857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 569
Target Start/End: Original strand, 39051372 - 39051420
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||| || ||| ||||| |
|
|
| T |
39051372 |
tttgatccatgtagtcgaccccacttagtaggataaagcctggttgttg |
39051420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 534 - 570
Target Start/End: Complemental strand, 43903957 - 43903921
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
43903957 |
gccgacctcacttagtgggataaggcttggttgttgt |
43903921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 2e-26; HSPs: 146)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 2885795 - 2885722
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2885795 |
tgatagaacactatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
2885722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 1011256 - 1011328
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1011256 |
gatagaacattatggtgtaatttgatctatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
1011328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 40980001 - 40979927
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40980001 |
tgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
40979927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 37618154 - 37618227
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37618154 |
tgatagaacactatggtgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
37618227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 502 - 570
Target Start/End: Original strand, 47852298 - 47852366
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47852298 |
atagaacattatggcgtaatttgatccatgtagccgaccccacttagggggataaggcttggctgttgt |
47852366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 502 - 573
Target Start/End: Original strand, 25891099 - 25891170
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
25891099 |
atagaacattatggtgtaatttgatccatgtagccgaccccacttagtacgataaggcttggttgttgttgt |
25891170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 11594169 - 11594242
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11594169 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
11594242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 12841348 - 12841275
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12841348 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
12841275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 27648989 - 27649062
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | | ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27648989 |
tgatagaacactgtggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
27649062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 28208401 - 28208328
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28208401 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
28208328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 31682675 - 31682602
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31682675 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
31682602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 39906445 - 39906372
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39906445 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
39906372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 43491517 - 43491590
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43491517 |
tgatagaacactatgatgtaatttcatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
43491590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 28708599 - 28708663
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
28708599 |
attatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgatgttgt |
28708663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 47652757 - 47652829
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| |||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47652757 |
gatagaacattatggcgtaacttgatccctgtagccgaccccacttagtgggataaggcttggttgttgttgt |
47652829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 29650591 - 29650666
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | || || || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29650591 |
tttgatagaacactaaggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
29650666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 31869177 - 31869102
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | | ||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31869177 |
tttgatagaacactctggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
31869102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 510 - 573
Target Start/End: Original strand, 42187660 - 42187723
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
42187660 |
ttatggcgtaatttgatccatgtagccgaccccacttagtgggataaggctttgttgttgttgt |
42187723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 43281881 - 43281956
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
43281881 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggacaaggcttggttgttgttgt |
43281956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 509 - 571
Target Start/End: Original strand, 6263477 - 6263539
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6263477 |
attatggcataatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgtt |
6263539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 6375077 - 6375147
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6375077 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgt |
6375147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 28628006 - 28627936
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
28628006 |
tgatagaacattatggcgtaatttgatccatgtagccgactccacttagtgggataaggcttagttgttgt |
28627936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 515 - 573
Target Start/End: Original strand, 31005429 - 31005487
Alignment:
| Q |
515 |
gtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31005429 |
gtgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
31005487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 44855236 - 44855174
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44855236 |
tatggcgtaatttggtccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
44855174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 9210777 - 9210704
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
9210777 |
tgatacaacattatggcgtaatttgatccatgtagctgaccccacttagtgggataaggcttcgttgttgttgt |
9210704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 499 - 572
Target Start/End: Complemental strand, 34029750 - 34029677
Alignment:
| Q |
499 |
ttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
34029750 |
ttgatagaacattatggcgtaatttgatccatgtagccaaccccaccaagtgggataaggcttggttgttgttg |
34029677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 36101850 - 36101777
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36101850 |
tgatagaacattatgacgtaatttgatccatgtagttgaccccacttagtgggataaggcttggttgttgttgt |
36101777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 45836555 - 45836482
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
45836555 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttgttgttgt |
45836482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 7273326 - 7273382
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7273326 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttgattgttgttgt |
7273382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 14057687 - 14057759
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||||||| ||||||||||| | |||||||| |
|
|
| T |
14057687 |
tgatagaacattatggggtaatttgatccatgtagccaaccccacttagtaggataaggcttagttgttgttg |
14057759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 14367715 - 14367787
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||||||| ||||||||||| | |||||||| |
|
|
| T |
14367715 |
tgatagaacattatggggtaatttgatccatgtagccaaccccacttagtaggataaggcttagttgttgttg |
14367787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 33103152 - 33103208
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
33103152 |
gtaatttgatccatgtagccgaccccacttagtaggataaggcttggctgatgttgt |
33103208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 33281097 - 33281168
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
33281097 |
gatagaacattatggtgtaatttgatccatgtagccg-gaccacttagtgggataaggcttggttgttgttgt |
33281168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 34035227 - 34035155
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
34035227 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggattaggcttggttgttgttg |
34035155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 510 - 573
Target Start/End: Original strand, 5418293 - 5418356
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
5418293 |
ttatggcgtaatttgatccatgtagtcgaccccatttagtgggataaggcttggttgttgttgt |
5418356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 31681093 - 31681022
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
31681093 |
tgatagaatactatgacgtaatttgatccatgtagccgaccccacttagtgggaaaaggcttggttgttgtt |
31681022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 32631771 - 32631846
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| ||||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32631771 |
tttgatagaacgctatggcgtcatttgatctatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
32631846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 35906274 - 35906211
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35906274 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttgg |
35906211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 34869629 - 34869703
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
34869629 |
tgatagaacactatggcgtcatttgatccatgtagccgaccctaattagtgggataaggcttggttgttgttgta |
34869703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 40630654 - 40630716
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
40630654 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttggttgttgttgt |
40630716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 45601685 - 45601755
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||| || | |||||||||||||||||||||| |||||| |
|
|
| T |
45601685 |
tgatagaacactatggtgtaatttgatccatgtagctgaactcacttagtgggataaggcttggttgttgt |
45601755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 4604756 - 4604829
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||| |||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
4604756 |
tgatagaacattatggcgtactttgatccatgtagccaaccccacttagtgggataagacttggttcttgttgt |
4604829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 517 - 574
Target Start/End: Complemental strand, 20158727 - 20158670
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
20158727 |
gtaatttgatccatgtagctgaccctacttagtgggataaggcttggttgttgttgta |
20158670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 21078126 - 21078199
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| || |||||||||||||||||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
21078126 |
tgatagaacattatggcgtcatttgatccatgtagccgacttcatttagtgggataaggcttggttgttgttgt |
21078199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 22349829 - 22349902
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22349829 |
tgatagaatactatggcgtcatttgatccatgtagtcgaccccacttagtgggataaggcttgattgttgttgt |
22349902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 27893636 - 27893563
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||| |||||||||||||| |||||||| |||||||||||| ||||||||| |
|
|
| T |
27893636 |
tgatagaacattatggcataatttgattcatgtagccgaccctacttagtgcgataaggcttggttgttgttgt |
27893563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 508 - 573
Target Start/End: Original strand, 29312206 - 29312271
Alignment:
| Q |
508 |
aattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29312206 |
aattatggcgtaatttgatccatgaagccgacccagcttagtgggataaggcttggttgttgttgt |
29312271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 36652201 - 36652274
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||||||||||||||||||| || || |||||| |
|
|
| T |
36652201 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttgctgttgt |
36652274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 561
Target Start/End: Original strand, 42969907 - 42969968
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||| ||| ||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42969907 |
tgattgaacattatcgtataatttgatccatgtagccgaccccacttagtgggataaggctt |
42969968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 29318851 - 29318795
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29318851 |
gtaatttgatccatgtagccgacccagcttagtgggataaggcttggttgttgttgt |
29318795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 20525107 - 20525052
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
20525107 |
taatttgatccatgtagccgaccccacttagcgggataaggctcggttgttgttgt |
20525052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 519 - 574
Target Start/End: Original strand, 33732060 - 33732115
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
33732060 |
aatttgatccatgtagccggtcccacttagtgggataaggcttggttgttgttgta |
33732115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 521 - 572
Target Start/End: Original strand, 34745977 - 34746028
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34745977 |
tttgattcatgtagccgaccccacttagtgggataaggcttggttgttgttg |
34746028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 509 - 572
Target Start/End: Complemental strand, 38103678 - 38103616
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
38103678 |
attatggtgtaatttgatcc-tgtagccgaccccagttagtgggataagacttggttgttgttg |
38103616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 38607199 - 38607274
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || ||||||||||||||||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
38607199 |
tttgatagaacactatggcgtcgtttgatccatgtagccgactccacttagtgggttaaggcttggttgttgttgt |
38607274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 510 - 573
Target Start/End: Original strand, 41483706 - 41483769
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
41483706 |
ttatggtgtcatatgatccatgtagccgaccccacttagtgggataagatttggttgttgttgt |
41483769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 520 - 571
Target Start/End: Complemental strand, 46355909 - 46355858
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
46355909 |
atttgatccatgtagccgaccccacttagtgagataaggcttggttgttgtt |
46355858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 511 - 574
Target Start/End: Original strand, 48919332 - 48919395
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
48919332 |
tatggcgtcatttgatccatgtagtcgaccccacttaatgggataaggcttggttgttgttgta |
48919395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 523 - 573
Target Start/End: Complemental strand, 36869287 - 36869237
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
36869287 |
tgatccatgtagccgaccccacttaatgggataaggcttggttgttgttgt |
36869237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 38900177 - 38900238
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
38900177 |
tatggcgtcatttgatccatgtagccgaccc-acttagtgggataaggcttggttgttgttgt |
38900238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 40139021 - 40138947
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| |||||| || |||||||||||||||| |||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
40139021 |
tgatagaatattatgacgtcatttgatccatgtagcagaccccacttagtgcgataagacttggctgttattgta |
40138947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 40149086 - 40149016
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| | ||||||||| |||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40149086 |
tgatagaacattatggcgcaatttgatctatgtagccgaatccacttagtgggataaggcttggttgttgt |
40149016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 7220965 - 7221038
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
7220965 |
tgatagaaaattatgacatcatttgatccatgtagccaaccccacttagtggtgtaaggcttggttgttgttgt |
7221038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 528 - 573
Target Start/End: Original strand, 14593989 - 14594034
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14593989 |
catgtagccgaccccacttagtgggataaggcttggttgttgttgt |
14594034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 528 - 573
Target Start/End: Original strand, 16013512 - 16013557
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16013512 |
catgtagccgaccccacttagtgggataaggcttggttgttgttgt |
16013557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 528 - 573
Target Start/End: Complemental strand, 21244328 - 21244283
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21244328 |
catgtagccgaccccacttagtgggataaggcttggttgttgttgt |
21244283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 30814198 - 30814125
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
30814198 |
tgatagaacattatcacgtaatttgatccatgtagccgaccccacttagtgggaagaggcttggtagttgttgt |
30814125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 33073158 - 33073211
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||| |||| |
|
|
| T |
33073158 |
atttgatccatgtagccgatcccacttagtgggataaggcttggttgttattgt |
33073211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 33349859 - 33349806
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
33349859 |
atttgatccatgtagccgacctcacttaatgggataaggcttggttgttgttgt |
33349806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 34341468 - 34341395
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||| | ||||||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
34341468 |
tgatagaacattatggcgtaatttgaccaatgtagccgaccccatttagtggaataaggcttgtttgttgttgt |
34341395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 38135286 - 38135213
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| |||| |||||||||| |||||| ||||||||| |||| |||| |
|
|
| T |
38135286 |
tgatagaatattatggcgtaatttgatccatctagctgaccccacttggtgggacaaggcttggttgttattgt |
38135213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 12966246 - 12966298
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
12966246 |
tttgattcatgtagccgatcccacttagtgggataaggcttggttgttgttgt |
12966298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 501 - 561
Target Start/End: Original strand, 17759483 - 17759543
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||| | |||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17759483 |
gatagaacactatggtgttgtttgattcatgtagccgaccccacttagtgggataaggctt |
17759543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 48515501 - 48515557
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
48515501 |
gtaatttgatccgtgtagccgaccccacttagtgggataagacttggtttttgttgt |
48515557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 521 - 568
Target Start/End: Original strand, 26847836 - 26847883
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26847836 |
tttgatccacgtagccgacccgacttagtgggataaggcttggctgtt |
26847883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 521 - 572
Target Start/End: Complemental strand, 39738497 - 39738446
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
39738497 |
tttgattcatgtagccaaccccacttagtgggataaggcttggttgttgttg |
39738446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 45054376 - 45054313
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| ||||||| |||||||| ||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
45054376 |
tgatagaatattatggcgtaatttggtccatgtagccgaccccacttggttggataatgcttgg |
45054313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 510 - 573
Target Start/End: Complemental strand, 47700118 - 47700056
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
47700118 |
ttatggcgtaatttgatccatgtagccga-cccacttggtgggaaaaggcttggttgttgttgt |
47700056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 521 - 563
Target Start/End: Original strand, 6682583 - 6682625
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6682583 |
tttgattcatgtagccgaccccacttagtgggataaggcttgg |
6682625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 28355374 - 28355448
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagcc-gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||| | ||||||||||| |||| | ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28355374 |
tgataaaacattatggcggaatttgatccacgtagtctgaccccacttagtgggataaggcttggttgttgttgt |
28355448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 39812147 - 39812217
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
39812147 |
tgatagaacattatgatgtcgtttgatccatgtagttggccccacttagtgggataaggcttggttgttgt |
39812217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 15682383 - 15682456
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| ||| |||||||||||||||| ||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
15682383 |
tgatagaacactatggcgtactttgatccatgtagccaaccccacttagtgagataaagcttggtagttgttgt |
15682456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 38504695 - 38504736
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38504695 |
tagccgaccccacttagcgggataaggcttggctgttgttgt |
38504736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 578
Target Start/End: Complemental strand, 48735953 - 48735896
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttc |
578 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||| |||| ||||||||| |||| |
|
|
| T |
48735953 |
tttgattcatgtagccaaccccacttagtgggataaggtttggttgttgttgttgttc |
48735896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 49029485 - 49029557
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||| |||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
49029485 |
tgatagaacactatggcgtcatttgatccatgtagccaaccccacttagtgggatacggc-tggttgttgttgt |
49029557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 17907780 - 17907724
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||| ||||| ||||||||| |
|
|
| T |
17907780 |
gtaatttgatccatgtagccgaccccatttagcaggataagacttggttgttgttgt |
17907724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 31840460 - 31840512
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
31840460 |
tttgattcatgtagcctaccctacttagtgggataaggcttggttgttgttgt |
31840512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 500 - 560
Target Start/End: Original strand, 48515380 - 48515440
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggct |
560 |
Q |
| |
|
|||||||| ||||||| ||||||| || |||||||||| ||| |||||||||||||||||| |
|
|
| T |
48515380 |
tgatagaacattatggcgtaattttattcatgtagccgccccaacttagtgggataaggct |
48515440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 530 - 573
Target Start/End: Complemental strand, 1531416 - 1531373
Alignment:
| Q |
530 |
tgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
1531416 |
tgtagccgaccccacttagtgggattaggcttggttgttgttgt |
1531373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 24376096 - 24376025
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||| ||| ||||||| |||||||||||||||||||||||| | |||||||||| |||| || | ||||||| |
|
|
| T |
24376096 |
tgatggaacattatggcgtaatttgatccatgtagccgacctcgcttagtgggacaaggttttgttgttgtt |
24376025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 519 - 574
Target Start/End: Complemental strand, 25579157 - 25579102
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||||||||| | |||||||||| |
|
|
| T |
25579157 |
aatttgatccatgtcgccgaccccactcagtggtataaggcttagttgttgttgta |
25579102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 28542017 - 28541942
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgacccc-acttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| || |||| || |||||||| ||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
28542017 |
tgatagaacatcatggcatagtttgatccgtgtagccgacccccacttagttggataaggcttggttgttgttgta |
28541942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 551
Target Start/End: Complemental strand, 40391896 - 40391845
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgg |
551 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
40391896 |
tgatagaacattatggcgtaatttgatccatctaaccgaccccacttagtgg |
40391845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 518 - 574
Target Start/End: Original strand, 40415234 - 40415296
Alignment:
| Q |
518 |
taatttgatccatgtagccgacccc------acttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
40415234 |
taatttgatccatgtagccgaccccacttatacttagtgggataaggcttggttgttgttgta |
40415296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 534 - 572
Target Start/End: Complemental strand, 635347 - 635309
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
635347 |
gccgaccccacttagtgggataaggcttggatgttgttg |
635309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 8492309 - 8492235
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| ||||| |||||||||| ||||| | ||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
8492309 |
tgatagaaaactatggcataatttgatcaatgtaactaaccccacttagtgagataaggctcgactgttgttgta |
8492235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 531 - 573
Target Start/End: Original strand, 20899411 - 20899453
Alignment:
| Q |
531 |
gtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20899411 |
gtagccggccccacttagtgggataaggcttggttgttgttgt |
20899453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 522 - 572
Target Start/End: Complemental strand, 24177678 - 24177628
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| |||||| |||||||| |
|
|
| T |
24177678 |
ttgatccatgtagccaaccccacttagtaggataaagcttggttgttgttg |
24177628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 523 - 573
Target Start/End: Complemental strand, 30200017 - 30199967
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
30200017 |
tgatctatgtagccggccccgcttagtgggataaggcttggttgttgttgt |
30199967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 535 - 573
Target Start/End: Complemental strand, 43424029 - 43423991
Alignment:
| Q |
535 |
ccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43424029 |
ccgaccccacttagtgggataaggcttggttgttgttgt |
43423991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 2882809 - 2882736
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||| || |||| |||| ||||||||| || ||||||||| |||||||| |
|
|
| T |
2882809 |
tgatagaacattatggcgtaatttgatctatttagctgacctcacttagtgagaaaaggcttggtggttgttgt |
2882736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 530 - 563
Target Start/End: Complemental strand, 12241728 - 12241695
Alignment:
| Q |
530 |
tgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12241728 |
tgtagccgaccccacttagtgggataaggcttgg |
12241695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 517 - 574
Target Start/End: Complemental strand, 32879248 - 32879191
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||||||||| || ||||||| |
|
|
| T |
32879248 |
gtaatttgatccttgtagccgaccctgcttagttggataaggcttggttggtgttgta |
32879191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 532 - 573
Target Start/End: Complemental strand, 33650911 - 33650870
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33650911 |
tagctgaccccacttagtgggataaggcttggttgttgttgt |
33650870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 512 - 557
Target Start/End: Complemental strand, 34926583 - 34926538
Alignment:
| Q |
512 |
atggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
34926583 |
atggcgtaatttgatccatgtagccgatcccacttagcgggataag |
34926538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 533 - 574
Target Start/End: Complemental strand, 35734731 - 35734690
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
35734731 |
agccgaccccacttagcgggataaggcttggttgttgttgta |
35734690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 533 - 574
Target Start/End: Original strand, 41157897 - 41157938
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41157897 |
agccgaccccacttagtgggataaggcttgattgttgttgta |
41157938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 44951364 - 44951437
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||||||||| ||||||||| |||||| |||| ||||||||| |
|
|
| T |
44951364 |
tgatagaacactatgacgtaatttgatccatgtagccgacaatacttagtggtataaggtttggttgttgttgt |
44951437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 578
Target Start/End: Complemental strand, 45841048 - 45840991
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttc |
578 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||| ||||| ||||||||| |||| |
|
|
| T |
45841048 |
tttgatccatgtagctgaccccaattagtggtataagacttggttgttgttgttgttc |
45840991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 562
Target Start/End: Complemental strand, 47155224 - 47155183
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47155224 |
tttgattcatgtagccgaccccacttagtgggataaagcttg |
47155183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 532 - 573
Target Start/End: Complemental strand, 47413756 - 47413715
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47413756 |
tagctgaccccacttagtgggataaggcttggttgttgttgt |
47413715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 1523869 - 1523925
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||| | |||||||||||| ||||||||| |
|
|
| T |
1523869 |
gtaatttgattcatgtagccaacctcacttagggagataaggcttggttgttgttgt |
1523925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 519 - 555
Target Start/End: Complemental strand, 27021779 - 27021743
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27021779 |
aatttgatccatgttgccgaccccacttagtgggata |
27021743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 28021165 - 28021217
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||||||||| || |||||| |||||||||||||||| ||||||||| |
|
|
| T |
28021165 |
tttgacccatgtagcctactccacttggtgggataaggcttggttgttgttgt |
28021217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 511 - 563
Target Start/End: Original strand, 30144975 - 30145027
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| |||||||||||| |||| | ||||||||||| |||||||||||| |
|
|
| T |
30144975 |
tatggtgtcatttgatccatgcagccaatcccacttagtgtgataaggcttgg |
30145027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 501 - 557
Target Start/End: Complemental strand, 35172137 - 35172081
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
35172137 |
gatagaaaattatgatgtcgtttgattcatgtagccgaccctacttagtgagataag |
35172081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 500 - 576
Target Start/End: Original strand, 36136973 - 36137049
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
|||||||| ||||| | |||||||||| || || |||| | | |||||||||||||||||||| |||||||||||| |
|
|
| T |
36136973 |
tgatagaacattatagggtaatttgatttatttaaccgatcgcgcttagtgggataaggcttggttgttgttgtagt |
36137049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 556
Target Start/End: Complemental strand, 19119476 - 19119441
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19119476 |
tttgattcatgtagccgaccccacttagtgggataa |
19119441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 520 - 571
Target Start/End: Original strand, 24777190 - 24777241
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||| ||||||||||| || |||||||||||||| |||||| ||||||| |
|
|
| T |
24777190 |
atttgattcatgtagccgatcctacttagtgggataaagcttggttgttgtt |
24777241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 502 - 573
Target Start/End: Complemental strand, 25731545 - 25731474
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||||| |||| | ||| ||||||||| ||||| ||||||||| |
|
|
| T |
25731545 |
atagaacattatggcgtaatttgatcaatgtagcagacctcgtttaatgggataagacttggttgttgttgt |
25731474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 572
Target Start/End: Complemental strand, 30914554 - 30914503
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||| | ||| |||||||||||||||||||||||||| | |||||| |
|
|
| T |
30914554 |
tttgatccatattgccaaccccacttagtgggataaggcttggttattgttg |
30914503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 517 - 552
Target Start/End: Complemental strand, 32789993 - 32789958
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtggg |
552 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32789993 |
gtaatttgatccatgtagctgaccccacttagtggg |
32789958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 38921163 - 38921085
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtag--ccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| ||||| || ||||||| ||||||| |||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
38921163 |
tttgatagaaggctatggcgtcatttgattcatgtaggaccgaccccacttagggggaaaaggcttggttgttgttgta |
38921085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 522 - 573
Target Start/End: Original strand, 41461341 - 41461392
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
41461341 |
ttgatccatgcagccaaccccggttagtgggataaggcttggttgttgttgt |
41461392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 518 - 573
Target Start/End: Original strand, 41948722 - 41948777
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| | |||| ||||||||| |
|
|
| T |
41948722 |
taatttcatccatgtagccaaccccacttagtggggtaatgtttggttgttgttgt |
41948777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 8519119 - 8519045
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| ||||| |||||||||| ||||| | ||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
8519119 |
tgatagaaaactatggcataatttgatcaatgtaactaaccccacttagtgagataaggctcgattgttgttgta |
8519045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 532 - 570
Target Start/End: Original strand, 30188504 - 30188542
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
30188504 |
tagccaaccccacttagtgggataaggcttggttgttgt |
30188542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 517 - 563
Target Start/End: Complemental strand, 35066801 - 35066755
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||| |||||||||||| |
|
|
| T |
35066801 |
gtaatttgatccatgttgccaaccacacttagtgagataaggcttgg |
35066755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 539 - 573
Target Start/End: Complemental strand, 35725605 - 35725571
Alignment:
| Q |
539 |
ccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35725605 |
ccccacttagtgggataaggcttggttgttgttgt |
35725571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 571
Target Start/End: Original strand, 40830431 - 40830481
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||||||||| ||||| | ||||||||||||||||| ||||||| |
|
|
| T |
40830431 |
tttgatccatgtagccaacccctcctagtgggataaggcttgattgttgtt |
40830481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 533 - 571
Target Start/End: Complemental strand, 48735721 - 48735683
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
48735721 |
agccgaccccacttagtggcataaggcttggttgttgtt |
48735683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 540 - 573
Target Start/End: Complemental strand, 3928379 - 3928346
Alignment:
| Q |
540 |
cccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
3928379 |
cccacttagtgggataaggcttggatgttgttgt |
3928346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 6807700 - 6807773
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| || | |||| ||||||| ||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
6807700 |
tgatagaacattatggcgtcgtatgattcatgtaggtgaccccacttagtgggataagatttggttgttgttgt |
6807773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 545
Target Start/End: Original strand, 22174209 - 22174254
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccact |
545 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
22174209 |
tgatagaacattatggcgttgtttgatccatgtagccgaccccact |
22174254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 26741967 - 26741894
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||| ||||| || | ||||||||||| | || |||||| ||||||||| |
|
|
| T |
26741967 |
tgatagaacattatggcgtaatttgatcaatgtaaccaatcccacttagtgcaaaaatgcttggttgttgttgt |
26741894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 533 - 574
Target Start/End: Original strand, 28359495 - 28359536
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| |
|
|
| T |
28359495 |
agccgaccccaattagtgggataaggctaggttgttgttgta |
28359536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 512 - 573
Target Start/End: Complemental strand, 35238836 - 35238775
Alignment:
| Q |
512 |
atggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||| |||||||||| ||||| | ||||| || ||||||||||| |||| |||| |
|
|
| T |
35238836 |
atggtgtaattttatccatgtagtcgaccacgcttagaggaataaggcttggttgtttttgt |
35238775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 40008504 - 40008431
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| || ||||||||||||||| |||| |||||| || |||||| ||||| ||||||||| |
|
|
| T |
40008504 |
tgatagaacattatgtcgttgtttgatccatgtagctgacctcacttaatgagataagacttggttgttgttgt |
40008431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 532 - 569
Target Start/End: Original strand, 44930952 - 44930989
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
44930952 |
tagctgaccccacttagtgggataaggcttggttgttg |
44930989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 549
Target Start/End: Complemental strand, 47796225 - 47796176
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagt |
549 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||| ||| |||||| |
|
|
| T |
47796225 |
tgatagaatattatggcgtaatttgatccatgcagccgatcccgcttagt |
47796176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 530 - 570
Target Start/End: Complemental strand, 30425174 - 30425134
Alignment:
| Q |
530 |
tgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
30425174 |
tgtagccgaccctacttagtgggataaagcttggttgttgt |
30425134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 33469738 - 33469674
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||||||||||| | |||||||||| ||||||||||| | ||||||| |
|
|
| T |
33469738 |
attatgatgtaatttgatccatgtagctagcttcacttagtggaataaggcttggtttttgttgt |
33469674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 500 - 568
Target Start/End: Original strand, 33871481 - 33871549
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||| || |||| ||||||||||||| ||||| |||| |
|
|
| T |
33871481 |
tgatagaacattatggcgtaatttcatccatgtaattgagcccagttagtgggataagacttggttgtt |
33871549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 500 - 536
Target Start/End: Complemental strand, 36239869 - 36239833
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagcc |
536 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
36239869 |
tgatagaacattatggcgtaatttgatccatgtagcc |
36239833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 516 - 552
Target Start/End: Original strand, 36613847 - 36613883
Alignment:
| Q |
516 |
tgtaatttgatccatgtagccgaccccacttagtggg |
552 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
36613847 |
tgtaagttgatccatgtagccaaccccacttagtggg |
36613883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 534 - 562
Target Start/End: Original strand, 40249247 - 40249275
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40249247 |
gccgaccccacttagtgggataaggcttg |
40249275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 2e-26; HSPs: 161)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 41560438 - 41560511
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41560438 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
41560511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 500 - 575
Target Start/End: Complemental strand, 40568483 - 40568408
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40568483 |
tgatagaaaactatggcgtaatttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgtag |
40568408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 21769784 - 21769710
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21769784 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgtgataaggcttggttgttgttgta |
21769710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 25715399 - 25715325
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
25715399 |
tgatagaatattatggcgtaatttgatccatgtagccgacctcacttagtgggataaggcttggttgttgttgta |
25715325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 8796418 - 8796491
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8796418 |
tgatagaacattatggcgtaatttaatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
8796491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 28090767 - 28090694
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
28090767 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataagacttggttgttgttgt |
28090694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 502 - 571
Target Start/End: Complemental strand, 37462947 - 37462878
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37462947 |
atagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgtt |
37462878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 44941849 - 44941776
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44941849 |
tgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
44941776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 4590605 - 4590533
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
4590605 |
tgatagaacaatatggtgtaatttgatccatgtagccgaccccacttagtgggataaggtttggttgttgttg |
4590533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 34444574 - 34444638
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34444574 |
attatggtgtaatttgatctatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
34444638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 515 - 573
Target Start/End: Complemental strand, 43481856 - 43481798
Alignment:
| Q |
515 |
gtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43481856 |
gtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
43481798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 49347466 - 49347392
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49347466 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
49347392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 50257779 - 50257853
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
50257779 |
tgatagaacattatggtgtaatttgatccatgtagccaaccccacttagtgagataaggcttcgttgttgttgta |
50257853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 1210954 - 1211027
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1210954 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
1211027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 25979304 - 25979231
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25979304 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
25979231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 29577461 - 29577534
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29577461 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
29577534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 30202203 - 30202130
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30202203 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
30202130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 38807744 - 38807671
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38807744 |
tgatagaacactatggcgtaatttgttccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
38807671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 503 - 572
Target Start/End: Complemental strand, 52561659 - 52561590
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52561659 |
tagaacattatggcgaaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttg |
52561590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 22175354 - 22175426
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
22175354 |
tgatagaacattatggtagaatttgatccatgtagccgaccccacttagtgggataaggcttggttggtgttg |
22175426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 52292248 - 52292320
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| || |||||||||||||||||||||||||| |||||||| |
|
|
| T |
52292248 |
tgatagaaaattattgagtaatttgatccatgtaaccaaccccacttagtgggataaggcttggttgttgttg |
52292320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 37311830 - 37311755
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
37311830 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttggttgttgttgt |
37311755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 52532689 - 52532619
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| |||||||||| |||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
52532689 |
tgatagaacattatggcgtaatttgattcatgtagccgaccccacttagtgggaaaaggcttggttgttgt |
52532619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 520 - 574
Target Start/End: Original strand, 52921309 - 52921363
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52921309 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
52921363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 4707293 - 4707221
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4707293 |
tgatagaacactatggcgtaatttgatc-atgtagccgaccccacttagtgggataaggcttggttgttgttgt |
4707221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 10200379 - 10200306
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |||||| |||||||| |||||| ||||||||| |
|
|
| T |
10200379 |
tgatagaacatcatggtgtaatttgatccatgtagccgacctcacttaatgggataatgcttggttgttgttgt |
10200306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 34792422 - 34792349
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
34792422 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttaatgggataaggcttggttgttgttgt |
34792349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 501 - 574
Target Start/End: Complemental strand, 38877415 - 38877342
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| ||||||| || ||||||||||||||||||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
38877415 |
gatagaacattatggcgtcatttgatccatgtagccgaacccacttagtgggataaggcttggttgtggttgta |
38877342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 501 - 570
Target Start/End: Original strand, 39140725 - 39140794
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
39140725 |
gatagaacattatggcgtaatttgattcatgtagccgaccccacttagtgggataatgcttggttgttgt |
39140794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 44751693 - 44751766
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
44751693 |
tgatagaacactatggcgtcatttgatccatgtagccgacctcacttagtgggataaggcttggttgttgttgt |
44751766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 51602265 - 51602338
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| || |||| || ||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51602265 |
tgatagaacatcatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgt |
51602338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 502 - 574
Target Start/End: Original strand, 2544804 - 2544876
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
2544804 |
atagaacattatggcataatttgatccatgtagccgaccccacttagtggtaaaaggcttggttgttgttgta |
2544876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 2914187 - 2914123
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2914187 |
attatggcgtactttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgt |
2914123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 41165500 - 41165564
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
41165500 |
attatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttggttgttgttgt |
41165564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 15086129 - 15086204
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | |||| || ||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15086129 |
tttgatagaacactatgacgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgt |
15086204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 520 - 575
Target Start/End: Original strand, 28533696 - 28533751
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
28533696 |
atttgatccatgtagccgaccccacttagtgggataagacttggttgttgttgtag |
28533751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 26299288 - 26299350
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||| || |||||| |
|
|
| T |
26299288 |
tatggcgtaatttgatccatgtagccgaccccacttagtgggataagacttggttgctgttgt |
26299350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 520 - 574
Target Start/End: Original strand, 42337785 - 42337839
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42337785 |
atttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgta |
42337839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 520 - 574
Target Start/End: Complemental strand, 46423269 - 46423215
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
46423269 |
atttgatccatgtagccgaccccacttagtgggataaggctcggttgttgttgta |
46423215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 696499 - 696552
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
696499 |
atttgatcaatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
696552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 4029351 - 4029404
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4029351 |
atttgatccatgtagccgaccccacttagtgggataagacttggttgttgttgt |
4029404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 4318898 - 4318845
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
4318898 |
atttgatccatgtagccgaccccacttagtgggaaaaggcttggttgttgttgt |
4318845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 7133375 - 7133302
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
7133375 |
tgatagaacattttggcctaatttgatccatgtagctgaccccacttagtgggaaaaggcttggttgttgttgt |
7133302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 9592963 - 9593016
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
9592963 |
atttgatccatgtagccgaccccacttaatgggataaggcttggttgttgttgt |
9593016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 22090325 - 22090378
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
22090325 |
atttgatccatgtagccgaccccactaagtgggataaggcttggttgttgttgt |
22090378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 29128992 - 29129065
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatcc-atgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||||||||||||||||||||| |||||||||||| | |||||| |
|
|
| T |
29128992 |
tgatagaacattatggtgtaatatgatcccatgtagccgaccccacttagtgagataaggcttggtttttgttg |
29129065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 32112062 - 32111989
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |||||||||| |||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
32112062 |
tgatagaacattatggcgtaatttgatcaatgtagccgaacccacttagttggaaaaggcttggttgttgttgt |
32111989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 512 - 573
Target Start/End: Complemental strand, 32404587 - 32404527
Alignment:
| Q |
512 |
atggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
32404587 |
atggcgtaatttgatccatgtagccgaccccacttagtgggataaggc-tggttgttgttgt |
32404527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 521 - 574
Target Start/End: Complemental strand, 33560910 - 33560857
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33560910 |
tttgatccatgtagccaaccctacttagtgggataaggcttggctgttgttgta |
33560857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 569
Target Start/End: Original strand, 40416580 - 40416649
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| ||||||||||||| |||||| | ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
40416580 |
tgatagaacattatggtgtaatgtgatccctttagccgaccccacttagtgggttaaggtttggctgttg |
40416649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 513 - 573
Target Start/End: Complemental strand, 42539272 - 42539212
Alignment:
| Q |
513 |
tggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
42539272 |
tggtgtaatttgatccatgtagacgaccccacttagtgggaaaaggcttggttattgttgt |
42539212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 45510889 - 45510833
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
45510889 |
gtaatttaatccatgtagccgaccccacttagtgggataaagcttggctgatgttgt |
45510833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 2429702 - 2429639
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
2429702 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
2429639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 502 - 573
Target Start/End: Original strand, 5338924 - 5338995
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||| ||||||||| ||||||||| || ||||||||| |
|
|
| T |
5338924 |
atagaacattatggcgtaatttgatccatgtagccaacctcacttagtgagataaggctcggttgttgttgt |
5338995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 17269062 - 17268999
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
17269062 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccatttagtgggaaaagtcttgg |
17268999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 500 - 555
Target Start/End: Complemental strand, 28511874 - 28511819
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
|||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28511874 |
tgatagaacattatggcgtaatttgatcaatgtagccgaccccacttagtgggata |
28511819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 526 - 573
Target Start/End: Complemental strand, 38758067 - 38758020
Alignment:
| Q |
526 |
tccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38758067 |
tccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
38758020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 562
Target Start/End: Complemental strand, 19908108 - 19908046
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||| ||| ||||| | ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19908108 |
tgattgaacattattgcgtaattttatccatgtagccgaccccacttagtgggataaggcttg |
19908046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 52981480 - 52981410
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| ||||||||| ||||||||| | |||| |||||| |
|
|
| T |
52981480 |
tgatagaatattatggtgtaatttgatccttgtagccaaccccacttggtgggataacgattggttgttgt |
52981410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 4001508 - 4001455
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
4001508 |
atttgatccatgtagccaaccccacttagtgggaaaaggcttggttgttgttgt |
4001455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 525 - 574
Target Start/End: Original strand, 12231592 - 12231641
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
12231592 |
atccatgtagccgaccccacttagtaggataaggcttggttgttgttgta |
12231641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 498 - 571
Target Start/End: Complemental strand, 15437203 - 15437130
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||| | |||||||| |||||| ||||||||| ||||||| |||||||||||||||||| ||||||| |
|
|
| T |
15437203 |
tttgatagaacactatggtgtcgtttgattcatgtagccaaccccacatagtgggataaggcttggttgttgtt |
15437130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 18469155 - 18469082
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| |||||||||||||||| | ||||||| ||||||||||||||||||||| |||| | ||||||||| |
|
|
| T |
18469155 |
tgatcgaacattatggtgtaatttggttcatgtagacgaccccacttagtgggataatgctttgatgttgttgt |
18469082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 19936669 - 19936742
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||| || ||||||||||||||||||||||| || |||||||||||||| |||| ||||||||| |
|
|
| T |
19936669 |
tgatagaacattacggcgtaatttgatccatgtagccgactccgcttagtgggataagacttgattgttgttgt |
19936742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 24020340 - 24020267
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||| |||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
24020340 |
tgatagaacactatggcgtcatttgatccatgcagccaaccccactttgtgggataaggcttggttgttgttgt |
24020267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 569
Target Start/End: Complemental strand, 27072560 - 27072491
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
27072560 |
tgatagaacattatggcgtaatttgatccatgtagccgaccatgcttagtgggaaaaggcttggttgttg |
27072491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 553
Target Start/End: Original strand, 27704159 - 27704212
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27704159 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccgcttagtggga |
27704212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 30396802 - 30396729
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||| |||||||| ||||||| |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
30396802 |
tgatagaacattatggtggcgtttgatccgtgtagccaaccccacttagtgggataaggcttggttgtttttgt |
30396729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 32079230 - 32079177
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
32079230 |
atttgatcgatgtagccgaccccacttggtgggataaggcttggttgttgttgt |
32079177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 38869091 - 38869164
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||||||||||||||||||| || |||||| || |||||| |
|
|
| T |
38869091 |
tgatagaacattatggcgtcgtttgatccatgtagccgaccccacttagtgggaaaatgcttggttgctgttgt |
38869164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 39318338 - 39318410
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
39318338 |
tgatagaacactatggcgtaatttgatccatgtagccga-cccgcttagtgggataaggcttgtttgttgttgt |
39318410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 50846771 - 50846844
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||| ||||||||||| ||||||||||||| || |||||| ||||||||| |
|
|
| T |
50846771 |
tgatagaacattatggcataatttgatctatgtagccgacaccacttagtgggaaaatgcttggttgttgttgt |
50846844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 37430484 - 37430420
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||| |||||||||| ||||||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
37430484 |
attatggcgtagtttgatccatatagccgatcccacttagtgagataaggcttggttgttgttgt |
37430420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 494 - 574
Target Start/End: Complemental strand, 43028887 - 43028807
Alignment:
| Q |
494 |
attgtttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| ||| ||| | |||||||| |||||| |||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43028887 |
attgttggatggaacactatggtgtcgtttgattcatgtaagcgaccccacttagtgggataaggcttggttgttgttgta |
43028807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 43240452 - 43240380
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| | ||||| || ||||||| ||||||||||||| |||||||||||||||||||| | |||||||| |
|
|
| T |
43240452 |
tgatagaacactatggcgtcatttgattcatgtagccgacctcacttagtgggataaggcttagttgttgttg |
43240380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 1290104 - 1290033
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||||||| ||| ||||||||||| | ||||||| |
|
|
| T |
1290104 |
tgatagaacattatggcataatttgatccatgtggccgaccccactcagttggataaggcttagttgttgtt |
1290033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 510 - 573
Target Start/End: Complemental strand, 31274464 - 31274401
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||| |||||| |||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
31274464 |
ttatggcgtaatttgatctgtgtagctgaccccacttagtgggataatgcttggttgttgttgt |
31274401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 37429972 - 37429909
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
37429972 |
tgatagcacattgtggtgtaatttgatccatgtagccgaccccatttaatgggataagggttgg |
37429909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 551
Target Start/End: Complemental strand, 39123441 - 39123391
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgg |
551 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39123441 |
tgatagaacattatggtgtaatttgatccatgtagccgacccc-cttagtgg |
39123391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 48431454 - 48431399
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
48431454 |
taatttgatccttgtagctgaccccacttagtaggataaggcttggttgttgttgt |
48431399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 36339877 - 36339803
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||| || |||||| ||||||||||||||||||| ||| ||||||||||||| || |||||| |||||||||| |
|
|
| T |
36339877 |
tgataaaacattatgaagtaatttgatccatgtagctgactccacttagtgggaaaatgcttggttgttgttgta |
36339803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 550
Target Start/End: Complemental strand, 48865780 - 48865730
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtg |
550 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
48865780 |
tgatagaatattatggtgtaatttgatccatgtagccaaccccactcagtg |
48865730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 1704836 - 1704909
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| || |||| ||||||||||||||| || |||||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
1704836 |
tgatagaacatcatggcataatttgatccatgttgctgaccccacttagtgtgataagacttggttgttgttgt |
1704909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 569
Target Start/End: Complemental strand, 2694492 - 2694423
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| |||||||| || |||||||||| |||| ||||||||||||||||||| || |||| ||||| |
|
|
| T |
2694492 |
tgatagaacattatggtatagtttgatccatttagcagaccccacttagtgggatacggtttggttgttg |
2694423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 3777313 - 3777260
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||| |||||| ||||||||| |
|
|
| T |
3777313 |
atttgatccatgtagccgatcccacttagtaggataatgcttggttgttgttgt |
3777260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 3818909 - 3818856
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
3818909 |
atttgatccatgtagccgactgcacttagtgggataaggcttggtcgttgttgt |
3818856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 8672147 - 8672200
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| ||||| |||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
8672147 |
atttgatccatatagccaaccccacttagtaggataaggcttggttgttgttgt |
8672200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 11584206 - 11584279
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||| ||||||||||||| || ||||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
11584206 |
tgataaaacattatggtataatttgatccatctaaccgactccacttagtgggataagacttgattgttgttgt |
11584279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 11941653 - 11941580
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||| ||| |||||||||||||| || || |||||||||||||| ||||||| ||||||||| |
|
|
| T |
11941653 |
tgataaaacattatggcgtattttgatccatgtagtcggcctcacttagtgggatacggcttggttgttgttgt |
11941580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 557
Target Start/End: Complemental strand, 26113512 - 26113455
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
26113512 |
tgatagaacattatggcttaatttgatccatgtagccgagctcacttagtgggataag |
26113455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 561
Target Start/End: Complemental strand, 32082809 - 32082768
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32082809 |
atttgatccatgtagccgaccccacttagtgggaaaaggctt |
32082768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 553
Target Start/End: Complemental strand, 37294181 - 37294128
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
37294181 |
tgatagaacattatggcgtaatttgatccatgtagctgaccccatttagtggga |
37294128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 43375671 - 43375598
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| | ||||||||||||||||| | |||| ||||||||| |
|
|
| T |
43375671 |
tgatagaacattatgacataatttgatccatgtagccaatcccacttagtgggataaagattggttgttgttgt |
43375598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 525 - 570
Target Start/End: Complemental strand, 50830682 - 50830637
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
50830682 |
atccatgtagccgaccccacttagtggggtaaggcttggttgttgt |
50830637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 51440818 - 51440765
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
51440818 |
atttgattcatgtaaccgaccccacttagtgggataagacttggttgttgttgt |
51440765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 522 - 571
Target Start/End: Complemental strand, 52073099 - 52073050
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
52073099 |
ttgatccatgtagccgaccccacttggtgggataaggcttgattgttgtt |
52073050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 511 - 572
Target Start/End: Original strand, 52815095 - 52815155
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
52815095 |
tatggcgtaatttgatccatgtagccgaccccgcttag-aggataaggcttggttgttgttg |
52815155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 518 - 570
Target Start/End: Complemental strand, 7210982 - 7210930
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| || || |||||| |
|
|
| T |
7210982 |
taatttgatccatgtaaccgaccccacttagtgggataagcctcggttgttgt |
7210930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 534 - 574
Target Start/End: Original strand, 29975442 - 29975482
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29975442 |
gccgaccccacttagtgggataaggcttggttgttgttgta |
29975482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 43898439 - 43898491
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
43898439 |
tttgattcatgtagccaaccccacttagtgggataatgcttggttgttgttgt |
43898491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 51584974 - 51585026
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
51584974 |
tttgattcatgtagcagaccccacttagtaggataaggcttggttgttgttgt |
51585026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 529 - 572
Target Start/End: Complemental strand, 853825 - 853782
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
853825 |
atgtagccgaccccacttagtgggataaggctcggttgttgttg |
853782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 534 - 573
Target Start/End: Complemental strand, 8809540 - 8809501
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8809540 |
gccgaccccacttagtgggataaggcttggttgttgttgt |
8809501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 555
Target Start/End: Complemental strand, 14225909 - 14225854
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14225909 |
tgatagaacagtatggtgtcgtttgatccatgtagccggccccacttagtgggata |
14225854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 27847873 - 27847810
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||| ||| |||||| ||||||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
27847873 |
tgatggaacattatgccgtaattttatccatgtagccgatctcacttagtgggataaggcttgg |
27847810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 563
Target Start/End: Original strand, 49377510 - 49377573
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| ||||||| | ||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
49377510 |
tgatagaacattatggcggtgtttgatccatgtagccgactccagttagtgggataaggcttgg |
49377573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 520 - 574
Target Start/End: Original strand, 4380189 - 4380242
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
4380189 |
attttatccatgtagccgaccc-acttagtgggataagacttggttgttgttgta |
4380242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 523 - 573
Target Start/End: Original strand, 7082536 - 7082586
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| || ||| ||||| |
|
|
| T |
7082536 |
tgatccatgtagccgaccccacttagtgggatatggctgggttgtggttgt |
7082586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 532 - 574
Target Start/End: Complemental strand, 19808266 - 19808224
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
19808266 |
tagccgacctcgcttagtgggataaggcttggctgttgttgta |
19808224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 563
Target Start/End: Complemental strand, 19908436 - 19908394
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
19908436 |
tttgatccatgtacctgaccccacttagtgggataaggcttgg |
19908394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 520 - 574
Target Start/End: Complemental strand, 35828615 - 35828561
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
35828615 |
atttgatccatgtaaccgaccccgcttagtgggaaaagacttggttgttgttgta |
35828561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 6025814 - 6025887
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| || |||| || ||||||||||||||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
6025814 |
tgatagaacatgatggcgtcatttgatccatgtagccgattccacttagtgggataatacttggttgtttttgt |
6025887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 6084184 - 6084257
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||| || | |||||||||||||||||||||| |||| |||| |
|
|
| T |
6084184 |
tgatagaacaatatggcgtaatttgatccatgtatttgatctcacttagtgggataaggcttggttgttattgt |
6084257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 509 - 558
Target Start/End: Original strand, 7124359 - 7124408
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataagg |
558 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
7124359 |
attatggtgtcgtttgatccatgtagctgacctcacttagtgggataagg |
7124408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 533 - 570
Target Start/End: Complemental strand, 8725849 - 8725812
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8725849 |
agccgaccccacttagtgggataaggcttggttgttgt |
8725812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 35672894 - 35672967
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| || | | |||||||||||||| ||||| || |||||| |
|
|
| T |
35672894 |
tgatagaatgttatggtgtaatttgatcgatgtagctgatctcgcttagtgggataagacttggttgatgttgt |
35672967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 534 - 575
Target Start/End: Original strand, 37831616 - 37831657
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
37831616 |
gccgaccccacttagtgggataaggcttggttgtttttgtag |
37831657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 39525974 - 39526047
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||| ||||| | ||||||||| |||||||| ||||||||| |
|
|
| T |
39525974 |
tgatagaatattatggcgtcgtttgatccatgtagctgaccctatttagtgggaccaggcttggttgttgttgt |
39526047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 574
Target Start/End: Original strand, 50806897 - 50806950
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| |||||| ||||||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
50806897 |
tttgattcatgtaaccgaccccatttagtggaataaggcttggttgttgttgta |
50806950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 532 - 576
Target Start/End: Original strand, 4298315 - 4298359
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
4298315 |
tagccaaccccacttagtgggataaggcctggttgttgttgtagt |
4298359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 517 - 557
Target Start/End: Complemental strand, 15785021 - 15784981
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
15785021 |
gtaatttgatccatgtagccgacctcatttagtgggataag |
15784981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 509 - 561
Target Start/End: Complemental strand, 43598986 - 43598934
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||| ||| ||||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
43598986 |
attatggcgtagtttgatccatgtagcagaccctacttactgggataaggctt |
43598934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 52814346 - 52814294
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||| |||| |||| |
|
|
| T |
52814346 |
tttgatccatgtagcctatcccacttagtgggttaaggcttggttgtttttgt |
52814294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 502 - 573
Target Start/End: Original strand, 4415560 - 4415631
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||| | |||||||||||||||||||| ||| ||||||| | ||| ||||| ||||||||| |
|
|
| T |
4415560 |
atagaacattatggcatcatttgatccatgtagccgactccatttagtggaaaaagacttggttgttgttgt |
4415631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 534 - 573
Target Start/End: Original strand, 6757462 - 6757501
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
6757462 |
gccgaccccacttagtgggataaggcttggttgatgttgt |
6757501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 7601361 - 7601409
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
7601361 |
tttgatccatgtagccgacccc----agtgggataaggcttggttgttgttgt |
7601409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 498 - 549
Target Start/End: Original strand, 8391979 - 8392030
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagt |
549 |
Q |
| |
|
|||||||||| | ||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
8391979 |
tttgatagaatactatggcgtcatttgatccatgtagccaaccccacttagt |
8392030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 510 - 565
Target Start/End: Original strand, 8807793 - 8807848
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggct |
565 |
Q |
| |
|
||||||||| |||||||||| ||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
8807793 |
ttatggtgtggtttgatccatttagtcgaccccacctagtgggataagacttggct |
8807848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 534 - 573
Target Start/End: Original strand, 21519167 - 21519206
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
21519167 |
gccgaccccacttagtgggataaagcttggttgttgttgt |
21519206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 509 - 556
Target Start/End: Original strand, 45935368 - 45935415
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
||||||| ||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
45935368 |
attatggagtaatttgatccatgtaacggacctcacttagtgggataa |
45935415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 534 - 573
Target Start/End: Original strand, 52901039 - 52901078
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52901039 |
gccgaccccacttagtgggataaggcttggtggttgttgt |
52901078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 520 - 570
Target Start/End: Complemental strand, 990519 - 990469
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||| |||||||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
990519 |
atttgattcatgtagccgacaccacttaacgggataaggcttggttgttgt |
990469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 515 - 573
Target Start/End: Complemental strand, 2462335 - 2462277
Alignment:
| Q |
515 |
gtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
2462335 |
gtgtaatttgatccatacagctaaccccacttagggggttaaggcttggttgttgttgt |
2462277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 558
Target Start/End: Complemental strand, 8676935 - 8676877
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataagg |
558 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
8676935 |
tgatagaatattatggcataatttgatccatgtagccgactccggttagtgggttaagg |
8676877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 558
Target Start/End: Complemental strand, 9599467 - 9599409
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataagg |
558 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||| ||||||||||| |||| |
|
|
| T |
9599467 |
tgatagaacgttatggcgtaatttgatccatgtagctgaccttacttagtgggaaaagg |
9599409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 563
Target Start/End: Original strand, 10272486 - 10272528
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
10272486 |
tttgattcatgtagccgaccccacttagtggaataaggtttgg |
10272528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 520 - 570
Target Start/End: Complemental strand, 15438849 - 15438800
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
15438849 |
atttgatgcatgtagccgaccccacttagt-agataaggcttggttgttgt |
15438800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 16943364 - 16943434
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||| ||||||||| ||||| ||||| |||||| |||||| |
|
|
| T |
16943364 |
tgatagaacattatggcggcgtttgatccatgtagtcgaccccacctagtgagataatgcttggttgttgt |
16943434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 523 - 561
Target Start/End: Complemental strand, 36623935 - 36623897
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
36623935 |
tgatccatgtagtcgaccctacttagtgggataaggctt |
36623897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 40920602 - 40920528
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgacccc-acttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||| |||||| ||||||| ||||||| |||||||||||| ||| |||| |||| |||| |
|
|
| T |
40920602 |
tgatagaatattatggtgtcttttgattcatgtagtcgacccccacttagtgggatcaggtttggttgttcttgt |
40920528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 52160316 - 52160242
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||| ||||||||| || |||||||||||| | ||| |||||||||| |
|
|
| T |
52160316 |
tgatagaatattatggtgacatttgatgcatatagccgacctcatttagtgggataaaacgtggttgttgttgta |
52160242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 2728858 - 2728911
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||||||||||||||| | |||||| || ||| ||||||||| |
|
|
| T |
2728858 |
atttgattcatgtagccgaccccacttactaggataatgcctggatgttgttgt |
2728911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 3059554 - 3059595
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
3059554 |
tagccgactccacttggtgggataaggcttggttgttgttgt |
3059595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 5113972 - 5114025
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||| || |||||||||||| | |||| ||||||||| |
|
|
| T |
5113972 |
atttgattcatgtagccgacctcaattagtgggataacgtttggttgttgttgt |
5114025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 10569124 - 10569071
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
10569124 |
atttgatccatgtagccggttccacttaaagggataaggcttggttgttgttgt |
10569071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 12930384 - 12930311
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||| ||||||||||| |||||| |||| ||||||||| |
|
|
| T |
12930384 |
tgatagaagattatgacgtaatttgatccgtgtagccaaccccacttagcaaaataaggattggttgttgttgt |
12930311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 569
Target Start/End: Complemental strand, 29577216 - 29577147
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| ||||||| |||||| | ||||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
29577216 |
tgatagaacattatggcataatttatttcatgtagccaaccccacttagtgggatagtgcttggttgttg |
29577147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 534 - 563
Target Start/End: Original strand, 31012417 - 31012446
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31012417 |
gccgaccccacttagtgggataaggcttgg |
31012446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 34863649 - 34863722
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||| | |||| |||||||||||| ||||| | ||||| |||||| |||| ||||||||| |
|
|
| T |
34863649 |
tgatagaacattatggtatcatttcatccatgtagccaaccccgcctagtgaaataaggattggttgttgttgt |
34863722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 537 - 573
Target Start/End: Original strand, 7922071 - 7922107
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
7922071 |
gaccccacttagtgggataagacttggttgttgttgt |
7922107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 525 - 557
Target Start/End: Complemental strand, 8203182 - 8203150
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
8203182 |
atccatgtagccgaccccacttagtgtgataag |
8203150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 561
Target Start/End: Complemental strand, 15707023 - 15706983
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
15707023 |
tttgatccacgcagccgtccccacttagtgggataaggctt |
15706983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 537 - 573
Target Start/End: Original strand, 22930639 - 22930675
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
22930639 |
gaccccacttagtgggataatgcttggttgttgttgt |
22930675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 529 - 569
Target Start/End: Complemental strand, 28833907 - 28833867
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
28833907 |
atgtagccgacctcacttagtgggataatgattggctgttg |
28833867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 537 - 573
Target Start/End: Complemental strand, 30985344 - 30985308
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30985344 |
gaccccacttagtgggataaggcttgtttgttgttgt |
30985308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 518 - 574
Target Start/End: Complemental strand, 31434369 - 31434313
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| || |||||||||||| ||||||||| ||||| |||||| |||||||||| |
|
|
| T |
31434369 |
taatttaattcatgtagccgacttcacttagtgagataaagcttggttgttgttgta |
31434313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 525 - 573
Target Start/End: Complemental strand, 37099810 - 37099762
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||||||||| | ||||||| |
|
|
| T |
37099810 |
atccatgtagccggccccacttggtgggaaaaggcttggttattgttgt |
37099762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 520 - 572
Target Start/End: Original strand, 44008807 - 44008859
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||||| ||||||| || |||||||| |||| ||||||| |||||||| |
|
|
| T |
44008807 |
atttgatccatttagccgaacctacttagtgagatacggcttggttgttgttg |
44008859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 557
Target Start/End: Complemental strand, 48861427 - 48861391
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
48861427 |
tttgattcatgtcgccgaccccacttagtgggataag |
48861391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 522 - 558
Target Start/End: Complemental strand, 49051227 - 49051191
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataagg |
558 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
49051227 |
ttgatacatgtagccgatcccacttagtgggataagg |
49051191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 522 - 558
Target Start/End: Complemental strand, 49062514 - 49062478
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataagg |
558 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
49062514 |
ttgatccatgtagccgatcctacttagtgggataagg |
49062478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 5e-24; HSPs: 67)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 12890784 - 12890857
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12890784 |
tgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
12890857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 28085585 - 28085658
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28085585 |
tgatagaacactatggtgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
28085658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 502 - 577
Target Start/End: Complemental strand, 18130885 - 18130810
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagtt |
577 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||| | ||||||||||||| |
|
|
| T |
18130885 |
atagaacattatggtgtaatttgatccatgtagccgaccccacctaatgggataaggcttagttgttgttgtagtt |
18130810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 34578 - 34505
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
34578 |
tgatagaacattatggcgtaatttgatccatgtagctgaccccacttagtgggataagacttggttgttgttgt |
34505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 498 - 574
Target Start/End: Original strand, 9706977 - 9707053
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | ||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9706977 |
tttgatagaacactatggcatcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
9707053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 502 - 577
Target Start/End: Complemental strand, 23888549 - 23888474
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagtt |
577 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||| || ||||||||||||| | ||||||||||||| |
|
|
| T |
23888549 |
atagaacattatggtgtaatttgatccatgtagcagaccccacctaatgggataaggcttagttgttgttgtagtt |
23888474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 520 - 575
Target Start/End: Complemental strand, 34934883 - 34934828
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34934883 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgtag |
34934828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 5096043 - 5096117
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |||||||||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
5096043 |
tgatagaacattatggcgtaatttgatctatgtagccgatcccacttagtgggataaggtttggttgttgttgta |
5096117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 30031465 - 30031535
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
30031465 |
tgatagaacactatggcgtaatttgatccatgtagccgacctcacttagtgggataaggcttggttgttgt |
30031535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 33730175 - 33730247
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33730175 |
tgataaaaaattatg-tataatttcatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
33730247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 505 - 573
Target Start/End: Original strand, 579632 - 579700
Alignment:
| Q |
505 |
gaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
579632 |
gaaaattatggcgtaatttgatctatgtagccgatcccacttagtgggataaagcttggttgttgttgt |
579700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 502 - 573
Target Start/End: Original strand, 30642980 - 30643051
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||||||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
30642980 |
atagaacattatggagtaatttgatctatgtagccgaccccacttagcgggttaaggcttggttgttgttgt |
30643051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 31818740 - 31818814
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||| |||| || |||||| |||||||||| |
|
|
| T |
31818740 |
tgatagaacattatgtcgtaatttgatccatgtagccgaccccacttagcgggaaaaagcttggttgttgttgta |
31818814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 561
Target Start/End: Original strand, 8364765 - 8364826
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
8364765 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccgcttagtgggaaaaggctt |
8364826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 31819040 - 31819113
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
31819040 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataatgcttggttgtggttgt |
31819113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 34143838 - 34143765
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
34143838 |
tgatagaacactatggcgtcatttgatccatgtagtcgaccccacttattgggataaggcttggttgttgttgt |
34143765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 34156454 - 34156381
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
34156454 |
tgatagaacactatggcgtcatttgatccatgtagtcgaccccacttattgggataaggcttggttgttgttgt |
34156381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 502 - 573
Target Start/End: Complemental strand, 3206530 - 3206459
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | ||||| || |||||||||||||||||||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
3206530 |
atagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataagacttggttattgttgt |
3206459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 502 - 576
Target Start/End: Complemental strand, 12119714 - 12119639
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgacccc-acttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
|||||| |||||| || ||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||| |
|
|
| T |
12119714 |
atagaacattatgacgtcatttgatccatgtagccgacccccacttagtgggataaggcttggttgttattgtagt |
12119639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 502 - 573
Target Start/End: Complemental strand, 12133973 - 12133902
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||||||||||||||||| || ||||||||| ||||||||| |
|
|
| T |
12133973 |
atagaacattatggcataatctgatccatgtagccgaccccacttagtgagaaaaggcttggttgttgttgt |
12133902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 498 - 572
Target Start/End: Original strand, 608368 - 608442
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||| | |||| || |||||||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
608368 |
tttgatagaatactatgacgtcatttgatccatgtagccgaccctacttagtgggataagacttggttgttgttg |
608442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 5258210 - 5258148
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||| ||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
5258210 |
tatggcgtcatttgatccacgtagccgaccccacttagtgggataagtcttggttgttgttgt |
5258148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 503 - 573
Target Start/End: Original strand, 5897669 - 5897739
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
5897669 |
tagaatattatgacgtaatttgatccatgtagcggatcccacttagtgggataaggcttgattgttgttgt |
5897739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 1008124 - 1008052
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
1008124 |
tgatagaacattatggcgtaatttgatccaggtagca-accccacttagtgggaaaaggcttggttgttgttgt |
1008052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 498 - 571
Target Start/End: Complemental strand, 30789149 - 30789076
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||| | |||| || ||||||||||||||||||| || ||||||||||||||||||||| ||||||| |
|
|
| T |
30789149 |
tttgatagaacactatgacgtcatttgatccatgtagccgatcctacttagtgggataaggcttggttgttgtt |
30789076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 32756130 - 32756203
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||| ||||||||||||| |||| ||||| ||||||||| |
|
|
| T |
32756130 |
tgatagaacactatggcgtcatttgatccatgtagccgatcccacttagtggggtaagacttggatgttgttgt |
32756203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 490 - 574
Target Start/End: Complemental strand, 1615306 - 1615222
Alignment:
| Q |
490 |
tcatattgtttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||| ||| |||||||| | |||| || ||||||||||||||||||||| || ||||||||||||| ||||| |||||||||| |
|
|
| T |
1615306 |
tcatagtgtatgatagaacactatgacgtcatttgatccatgtagccgacctcatttagtgggataagacttggttgttgttgta |
1615222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 4245924 - 4245872
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
4245924 |
tttgatccaagtagccgaccccacttagtgggataaggcttggttgtttttgt |
4245872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 7337268 - 7337193
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccactt--agtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||| ||||||||||||||||||||| || ||||||| |||||| ||||||||| |
|
|
| T |
7337268 |
tgatagaatattatggcgtaatttggtccatgtagccgaccccacttagagggggataaagcttggttgttgttgt |
7337193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 517 - 563
Target Start/End: Original strand, 5983857 - 5983903
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
5983857 |
gtaatttgatccacgtagccgaccccactcagtgggataaggcttgg |
5983903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 9593781 - 9593710
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||| |||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
9593781 |
tgatagaacattatggt--aatttgatccatatagctgaccacacttagtggcataaggcttggttgttgttgt |
9593710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 21089606 - 21089676
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| | ||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
21089606 |
tgatagaacattatggcattgtttgatccatgtagctgcccccacttagtgggataaggcttggttgttgt |
21089676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 29900275 - 29900328
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||| | ||||||| |
|
|
| T |
29900275 |
atttgatccatgtagccgacccctcttagtgggataaggattggttcttgttgt |
29900328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 32945457 - 32945530
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| |||||||| | ||||||||||| ||| ||||| |
|
|
| T |
32945457 |
tgatagaacattatggtgtcgtttgatccatgtagccgacatcacttagttgaataaggcttggttgtcgttgt |
32945530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 521 - 572
Target Start/End: Original strand, 5053756 - 5053807
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
5053756 |
tttgatcaatgtagccgaccccatttagtaggataaggcttggttgttgttg |
5053807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 509 - 556
Target Start/End: Original strand, 32068638 - 32068685
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
32068638 |
attatggcgtaatttgatacatgtagccgatcccacttagtgggataa |
32068685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 529 - 563
Target Start/End: Complemental strand, 6293436 - 6293402
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6293436 |
atgtagccgaccccacttagtgggataaggcttgg |
6293402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 520 - 574
Target Start/End: Complemental strand, 6692749 - 6692695
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| ||||||| ||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
6692749 |
atttgattcatgtagtcgaccccacttggtgggaaaaggcttggttgttgttgta |
6692695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 501 - 571
Target Start/End: Original strand, 7492599 - 7492669
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||| ||||| | || ||||| ||| |||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
7492599 |
gatagaacattatagcgttatttgtaccaagtagccgaccccacttagtgggataaggattggttgttgtt |
7492669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 520 - 570
Target Start/End: Original strand, 21886333 - 21886383
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| | |||||| |
|
|
| T |
21886333 |
atttgatccatgtagccgaccccatttagtggtataaggcttagttgttgt |
21886383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 523 - 573
Target Start/End: Original strand, 29931068 - 29931118
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||| | ||||||| |
|
|
| T |
29931068 |
tgatccatgtagccgaccccgcttagtaggataaggcttggttcttgttgt |
29931118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 562
Target Start/End: Complemental strand, 30856801 - 30856739
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
30856801 |
tgatagaaaattatggcaaaatttgatgcatttagcagaccccactaagtgggataaggcttg |
30856739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 9109582 - 9109509
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||| ||| ||||||||||||||||||||||| |||||| ||||| |||| | ||||||||| |
|
|
| T |
9109582 |
tgatagaatactatgaagtagtttgatccatgtagccgaccccagttagtgagataatgcttagttgttgttgt |
9109509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 10098949 - 10098896
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
10098949 |
atttgatccatgtaatcgaccccacttagtgggataagacttgattgttgttgt |
10098896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 570
Target Start/End: Complemental strand, 21870118 - 21870069
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
21870118 |
tttgatccatgcagccgacctcacttagtgggataaggtttggttgttgt |
21870069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 500 - 540
Target Start/End: Complemental strand, 3210581 - 3210541
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgacc |
540 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
3210581 |
tgatagaacattatggtgtaatttgatccatgtagctgacc |
3210541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 509 - 556
Target Start/End: Original strand, 34939317 - 34939365
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccga-ccccacttagtgggataa |
556 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||| |||| |
|
|
| T |
34939317 |
attatggtgtaatttgatccatatagccgacccccacttagtggcataa |
34939365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 38978 - 39053
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||| ||||||||||| ||||| |||||||||||||| || ||||||||| |
|
|
| T |
38978 |
tttgatagaacactatggcgttgtttgattcatgtagccgagtccactaagtgggataaggctcggttgttgttgt |
39053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 43125 - 43062
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| || || |||||||||||||||| ||||| |
|
|
| T |
43125 |
tgatagagtattatggtgtaattttatccatgtatccagcctcacttagtgggataagacttgg |
43062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 522 - 573
Target Start/End: Complemental strand, 6906878 - 6906827
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||| ||| | ||||||||| |
|
|
| T |
6906878 |
ttgatccatgtagccgacccaacttagtgcgataagactttgatgttgttgt |
6906827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 500 - 555
Target Start/End: Complemental strand, 7513063 - 7513008
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
|||||||| |||||| ||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
7513063 |
tgatagaacattatgacgtaatttgatctatgtagttgaccccacttagtgggata |
7513008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 507073 - 507146
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| |||||| || ||||| ||| ||||||||||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
507073 |
tgatagaacattatgatggaatttaatc-atgtagccgactttacttagtgggatatggcttggttgttgttgta |
507146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 504 - 570
Target Start/End: Complemental strand, 655463 - 655397
Alignment:
| Q |
504 |
agaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||| ||| ||||| |||||||||||||||| |||| ||||||||||||||| | |||| |||||| |
|
|
| T |
655463 |
agaacattgtggtgcaatttgatccatgtaggtgacctcacttagtgggataaagtttggttgttgt |
655397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 533 - 570
Target Start/End: Complemental strand, 451989 - 451952
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
451989 |
agccgaccccacttggtgggataaggcttggttgttgt |
451952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 498 - 567
Target Start/End: Original strand, 10453270 - 10453339
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgt |
567 |
Q |
| |
|
|||||||||| | ||||| || |||||| ||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
10453270 |
tttgatagaacactatggcgtcttttgattcatgtagccgaccatgcttactgggataaggcttggctgt |
10453339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 553
Target Start/End: Original strand, 28891486 - 28891539
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||| ||||||| |||||||||| |
|
|
| T |
28891486 |
tgatagaacattatggtgtaatttaatacatgtaaccgacccttcttagtggga |
28891539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 553
Target Start/End: Original strand, 32080678 - 32080731
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
||||| || ||||||| |||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
32080678 |
tgatataacattatggcgtaatttgatacatgtagtcgatcccacttagtggga |
32080731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 500 - 568
Target Start/End: Original strand, 2079490 - 2079558
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
||||||| ||||| | ||||||| ||||||||||||||| | |||||||||| ||||| |||| |||| |
|
|
| T |
2079490 |
tgatagagcattatagcgtaatttaatccatgtagccgactcgacttagtggggtaaggtttggttgtt |
2079558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 4334972 - 4335044
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||| |||||| || ||||||||||| | || ||||||| |||| | |||| ||||||||| |
|
|
| T |
4334972 |
gatagaatattatggtataatttaattcatgtagccgatctcatttagtggaataaagtttggttgttgttgt |
4335044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 537 - 573
Target Start/End: Complemental strand, 4878333 - 4878297
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
4878333 |
gaccccacttagtgtgataaggcttggttgttgttgt |
4878297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 522 - 574
Target Start/End: Complemental strand, 7150362 - 7150310
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||| || | ||||||||| |||||||| |||||||||| |
|
|
| T |
7150362 |
ttgatccatgtagccgagcctatgtagtgggattaggcttggttgttgttgta |
7150310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 7267437 - 7267385
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||| |||||| | ||||||| |
|
|
| T |
7267437 |
tttgatccatgtagcagaccccacatagtgagataaagcttgggttttgttgt |
7267385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 533 - 573
Target Start/End: Complemental strand, 24698897 - 24698857
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
24698897 |
agccgatcccatttagtgggataaggcttggttgttgttgt |
24698857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 533 - 573
Target Start/End: Complemental strand, 27840090 - 27840050
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
27840090 |
agccgaccccacttagtgggtcaaggcttggttgttgttgt |
27840050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 30537221 - 30537277
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||| || ||||||||| ||||||||| |
|
|
| T |
30537221 |
gtaatttgatccatgcagccgacgccaattagttgggcaaggcttggttgttgttgt |
30537277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 500 - 556
Target Start/End: Original strand, 32097946 - 32098002
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
||||| || ||||||| |||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
32097946 |
tgatataacattatggcgtaaattgatacatgtagccgattccacttagtgggataa |
32098002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 35043516 - 35043440
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | |||| || |||||||| ||||||| || |||||||| | |||||||||||| |||||||||| |
|
|
| T |
35043516 |
tttgatagaacactatgacgtcatttgatcaatgtagctgatcccacttaaagagataaggcttggttgttgttgta |
35043440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 5e-24; HSPs: 120)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 38132545 - 38132618
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38132545 |
tgatagaacattatggcgtaatttgatccatgtggccgaccccacttagtgggataaggcttggttgttgttgt |
38132618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 14667980 - 14668053
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
14667980 |
tgatagaacattatggtgtaatttgatccatgtaaccgaccccacttagtgggataagacttggttgtagttgt |
14668053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 509 - 574
Target Start/End: Original strand, 27386558 - 27386623
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
27386558 |
attatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcatggttgttgttgta |
27386623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 28276447 - 28276520
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| || |||||||| |||||||||||||| ||||||||| |
|
|
| T |
28276447 |
tgatagaaaactatggtgtaatttgatccatgtagccaactccacttagcgggataaggcttggttgttgttgt |
28276520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 29816591 - 29816664
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29816591 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
29816664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 42576219 - 42576292
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| || |||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
42576219 |
tgatagaacataatggcgtaatttgatccatgtagccgacccgacttagtgggataaggcttggttgttgttgt |
42576292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 498 - 574
Target Start/End: Original strand, 3302051 - 3302127
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | || || || |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3302051 |
tttgatagaacactacggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
3302127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 20456982 - 20457054
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20456982 |
tgatagaacattatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttgattgttgttg |
20457054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 499 - 571
Target Start/End: Original strand, 27800036 - 27800108
Alignment:
| Q |
499 |
ttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
27800036 |
ttgatagaacattatggtataatttgatacatgtagccaaccccacttagtgggataaggcttggttgttgtt |
27800108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 502 - 573
Target Start/End: Complemental strand, 408565 - 408494
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
408565 |
atagaatactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
408494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 13561461 - 13561386
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13561461 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttgtttgttgttgt |
13561386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 418107 - 418034
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||| |||||||| |||||| ||||||||| |
|
|
| T |
418107 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttggtgggatatggcttgaatgttgttgt |
418034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 496 - 573
Target Start/End: Original strand, 1275469 - 1275546
Alignment:
| Q |
496 |
tgtttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
1275469 |
tgtttgatagaacattatgacgtcatttgatccatgtagccgaccccacttagtgggataaggcatagttgttgttgt |
1275546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 2915569 - 2915496
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
2915569 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttattgttgt |
2915496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 4496613 - 4496666
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4496613 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
4496666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 5558350 - 5558423
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
5558350 |
tgatagaacactatggcataatttgatccatgtagccgaccccacttagtgggataaggcttggttgtcgttgt |
5558423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 10639511 - 10639584
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
10639511 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccactttgtgggataaggcttggttgttgttgt |
10639584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 11675739 - 11675812
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||| ||| ||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
11675739 |
tgatagaacattatggcgtagtttaatccatgtagccgaccccacttagttggataaggcttggttgttgttgt |
11675812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 12492457 - 12492384
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12492457 |
tgatagaacactatggcgtcatttgatgcatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
12492384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 18855816 - 18855889
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| | |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
18855816 |
tgatagaacattatagcataatttgatccatgtagccgaccccacttagtgggataagacttggttgttgttgt |
18855889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 28976932 - 28976859
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28976932 |
tgatagaacactatggcgtcatttgattcatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
28976859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 30213784 - 30213857
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
30213784 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgtttttgt |
30213857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 41894282 - 41894355
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
41894282 |
tgatacaacattatggtgtaatttgatccatgtagccaaccccacttagtgggataagactttgttgttgttgt |
41894355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 14665938 - 14665994
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14665938 |
gtaatttgatctatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
14665994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 36551364 - 36551428
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
36551364 |
attacggtataatttgatccatgtagccgaccccacttagtgagataaggcttggttgttgttgt |
36551428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 500 - 563
Target Start/End: Original strand, 38685176 - 38685239
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38685176 |
tgatagaacaatatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttgg |
38685239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 502 - 572
Target Start/End: Complemental strand, 30639787 - 30639717
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||| |
|
|
| T |
30639787 |
atagaacattgtggtgtaatttgatccatgtagccgaccccatttagtgggataaggattggtagttgttg |
30639717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 5860043 - 5860116
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5860043 |
tgatagaccattatggcgtaatttgatctatgtagccgaccctacttagtgggataaggcttgattgttgttgt |
5860116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 11069235 - 11069162
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| |||| |||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
11069235 |
tgatagaacattatggcgtaatttgatccatatagctgaccccacatagtgggatatggcttggttgttgttgt |
11069162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 28411885 - 28411958
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28411885 |
tgatagaacactatggcgttgtttgattcatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
28411958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 577
Target Start/End: Complemental strand, 43557906 - 43557829
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagtt |
577 |
Q |
| |
|
|||||||| |||||| ||| |||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
43557906 |
tgatagaacattatgacttaagttgatctatgtagccgaccccacttagtgggataaggcctggttgttgttgtagtt |
43557829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 518 - 574
Target Start/End: Original strand, 9234113 - 9234169
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9234113 |
taatttgatccatgtaaccgaccccacttagtgggataaggcttgattgttgttgta |
9234169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 500 - 568
Target Start/End: Original strand, 28985292 - 28985360
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||| ||||| | |||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
28985292 |
tgatagaacattatagcttaatttgatccatgtagccgaccccacttagtgggacaaggcttggttgtt |
28985360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 29922494 - 29922566
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| ||| ||||| |||||||||| ||||| ||||||||| |
|
|
| T |
29922494 |
gatagaacattatggcgtaatttgatccatgtagccaacctcacttggtgggataagccttggttgttgttgt |
29922566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 501 - 557
Target Start/End: Complemental strand, 32442197 - 32442141
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32442197 |
gatagaacattatggcgtaatttgatccatgtagccgactccacttagtgggataag |
32442141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 42272687 - 42272759
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| || |||||||||||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
42272687 |
gatagaacattatggcgtcatttgatccatgtagctgaccccacttagtgggataaggctaagttgttgttgt |
42272759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 520 - 583
Target Start/End: Original strand, 3000968 - 3001031
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttccatat |
583 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
3000968 |
atttgatggatgtagccgaccccacttagtgggataaggcttggttgttgttgtacttcaatat |
3001031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 520 - 574
Target Start/End: Complemental strand, 16913936 - 16913881
Alignment:
| Q |
520 |
atttgatccatgtagccgacccc-acttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
16913936 |
atttgatccatgtagccgacccccacttagtgggataaggcttggttgttgttgta |
16913881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 520 - 579
Target Start/End: Complemental strand, 41200399 - 41200340
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttcc |
579 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
41200399 |
atttgatccatgtagcctaccccacttagtgggataaggccttgctgttgttgttgttcc |
41200340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 510 - 573
Target Start/End: Original strand, 43475458 - 43475521
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| |||||| || ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
43475458 |
ttatggtgtaatttgatccacgtagccaactccacttaatgggataaggcttggttgttgttgt |
43475521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 562
Target Start/End: Complemental strand, 15252817 - 15252755
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||| |||||| |||| ||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15252817 |
tgatagaacattatgatgtagtttaattcatgtagccgaccccacttagtgggataaggcttg |
15252755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 520 - 574
Target Start/End: Complemental strand, 16347433 - 16347379
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
16347433 |
atttgatccatgtagccgaccctacttagtgggataagacttggttgttgttgta |
16347379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 519 - 573
Target Start/End: Complemental strand, 26884743 - 26884689
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
26884743 |
aatttgatccatgtagccgaccccacttagtggaataaggcttgattgttgttgt |
26884689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 522 - 563
Target Start/End: Complemental strand, 1287630 - 1287589
Alignment:
| Q |
522 |
ttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287630 |
ttgatccatgtagccgaccccacttagtgggataaggcttgg |
1287589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 498 - 571
Target Start/End: Complemental strand, 3442946 - 3442873
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||| | ||||| || |||||| |||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
3442946 |
tttgatagaacactatggcgtcgtttgattcatgtagccgaccccacttagtggcataaggcttggttgttgtt |
3442873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 6859590 - 6859663
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6859590 |
tgatagaacattatggcataattttatccatgttgctgaccccacttagtgggataaggcttggtagttgttgt |
6859663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 561
Target Start/End: Original strand, 9235256 - 9235316
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9235256 |
tgatagaacattatggcataatttgatccatgtagccga-cccacttagtgggataaggctt |
9235316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 498 - 571
Target Start/End: Original strand, 14911379 - 14911452
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||| ||| |||||| |||| ||||||| |
|
|
| T |
14911379 |
tttgatagaatactatggcgtcatttgatccatgtagccgaccccacttaatggaataaggtttggttgttgtt |
14911452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 569
Target Start/End: Complemental strand, 38501491 - 38501422
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||| ||| ||||||| ||||| |||||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
38501491 |
tgatagaaaactatagtgtaatatgatcgatgtagccgatcccacttagtgggataagacttggttgttg |
38501422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 41108802 - 41108726
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccactta--gtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| | ||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
41108802 |
tgatagtacattatggcgtaatttgatccatgtagctgaccccacttagtgtgggataaggcttgattgttgttgta |
41108726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 2090631 - 2090695
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| | ||||||||||||||| | ||||||||| |
|
|
| T |
2090631 |
attatggcgtaatttgatccatgtacccgaccccattgagtgggataaggctttgttgttgttgt |
2090695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 2645220 - 2645272
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
2645220 |
tttgatccatgtagccggccctacttagtgggataaggcttggttgttgttgt |
2645272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 7359317 - 7359261
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
7359317 |
gtaatttgatccatgtagctgaccccacttagtgggacaagacttggttgttgttgt |
7359261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 7678707 - 7678759
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
7678707 |
tttgatccatgtagccgaccccacttagtgggataaaacttggttgttgttgt |
7678759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 12576933 - 12576861
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||| |||||||||| |||| || |||||||||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
12576933 |
tgatagaccattatggtgtcattttatacatgtagccgaccccaattagtgggataaagcttggttgttgttg |
12576861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 2075546 - 2075475
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| | ||||| || ||||||| ||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
2075546 |
tgatagaatactatggcgtcatttgattcatgtagccaaccccacttagtgggataaggcttgattgttgtt |
2075475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 520 - 571
Target Start/End: Original strand, 10668569 - 10668620
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
10668569 |
atttgatcaatgtagccgaccccacttattgggataaggcttggttgttgtt |
10668620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 510 - 557
Target Start/End: Complemental strand, 39322142 - 39322095
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39322142 |
ttatggcgtaatttgatccatgtagccgatcccacttagtgggataag |
39322095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 7640580 - 7640510
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| | || || |||||||||||||||||||||| |||||||||||| |||||||| || |||||| |
|
|
| T |
7640580 |
tgatagaacactacggcgtaatttgatccatgtagccgatcccacttagtggaataaggctcggttgttgt |
7640510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 520 - 569
Target Start/End: Complemental strand, 8082017 - 8081967
Alignment:
| Q |
520 |
atttgatccatgtagccgacccc-acttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
8082017 |
atttgatccatgtagccgacccccacttagtgggataaggcttggttgttg |
8081967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 532 - 574
Target Start/End: Complemental strand, 10989126 - 10989084
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10989126 |
tagccgaccccacttagtgggataaggcttggttgttgttgta |
10989084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 28186855 - 28186781
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||||||| || ||||||||||| ||||||||| ||| | ||||||||||||||| |||||||||| |
|
|
| T |
28186855 |
tgatagaacattatggcgtcgtttgatccatgcagccgaccctactcaatgggataaggcttggttgttgttgta |
28186781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 499 - 573
Target Start/End: Original strand, 38684688 - 38684762
Alignment:
| Q |
499 |
ttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| ||||||| || ||||||| ||||||| ||||||||||||||| |||| |||||| ||||||||| |
|
|
| T |
38684688 |
ttgatagaacattatggcgttatttgattcatgtagttgaccccacttagtggaataaagcttggttgttgttgt |
38684762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 509 - 574
Target Start/End: Complemental strand, 218116 - 218051
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| || ||| ||||||||||||||||||||| |||||||||||| ||||| |||| ||||| |
|
|
| T |
218116 |
attatggcgtcattagatccatgtagccgaccccacctagtgggataagacttggttgttattgta |
218051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 557
Target Start/End: Complemental strand, 683774 - 683717
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||| |||||| |||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
683774 |
tgatagaacattatgttgtagtttgatccatgtagccaaccccacttagcgggataag |
683717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 509 - 570
Target Start/End: Complemental strand, 14330232 - 14330171
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||| ||||||||||| |||| | |||||| |
|
|
| T |
14330232 |
attattgtgtaatttgattcatgtagccgaccccacatagtgggataaagctttgatgttgt |
14330171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 32366187 - 32366260
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| || ||||||||||||| ||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
32366187 |
tgatagaacattatgacgtcatttgatccatgtggccaaccccatgtagtgggataaggcttggttgttgttgt |
32366260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 38830529 - 38830601
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| | |||||| |||||||||||| ||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
38830529 |
tgatagaacattatagcgtaatt-gatccatgtagctgaccccacttagtgggaaaaggtttggttgttgttgt |
38830601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 509 - 562
Target Start/End: Complemental strand, 43423559 - 43423506
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
43423559 |
attatggcgtaatttgatccatgtagccaaccccttttagtgggataaggcttg |
43423506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 525 - 573
Target Start/End: Complemental strand, 7367220 - 7367172
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||| |||| |
|
|
| T |
7367220 |
atccatgtagccgacccgacttagtgggataaggcttggttgttattgt |
7367172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 9121130 - 9121078
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
9121130 |
tttgattcatgtagccgacctcacttagtgggataaggcttggttgtcgttgt |
9121078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 529 - 573
Target Start/End: Complemental strand, 9917504 - 9917460
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
9917504 |
atgtagccgaccccacttagtgggttaaggcttggttgttgttgt |
9917460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 20367119 - 20367175
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
20367119 |
gtaatttgatccatatagccaaccccacttggtaggataaggcttggttgttgttgt |
20367175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 35118378 - 35118322
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| |||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
35118378 |
gtaatttgatccatgtacccgacctcatttagtgggataaggcttgattgttgttgt |
35118322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 521 - 568
Target Start/End: Original strand, 2713166 - 2713213
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
2713166 |
tttgattcatgtagccgagcccacttagtgggataaggcttggttgtt |
2713213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 518 - 573
Target Start/End: Original strand, 4653479 - 4653534
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
4653479 |
taatttgattcatgtatccgaccccacttagtgagataagacttggttgttgttgt |
4653534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 517 - 568
Target Start/End: Original strand, 5987742 - 5987793
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
5987742 |
gtaatttgatcaatgtagccgaccccacttagtggaataagacttgactgtt |
5987793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 534 - 573
Target Start/End: Complemental strand, 13607036 - 13606997
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13607036 |
gccgaccccacttagtgggataaggcttggttgttgttgt |
13606997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 504 - 563
Target Start/End: Complemental strand, 15588459 - 15588400
Alignment:
| Q |
504 |
agaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||| ||||||| || ||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15588459 |
agaacattatggcgtcgtttgatctatgtagccgaccctacttagtgggataaggcttgg |
15588400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 525 - 572
Target Start/End: Complemental strand, 16014532 - 16014485
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| |||||||| |
|
|
| T |
16014532 |
atccatgtagccgaccccacttagtgggaaaagggttggttgttgttg |
16014485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 19137962 - 19137907
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
19137962 |
taatttgatccatgcagccaaccccacttagtgggataagggttggttgtcgttgt |
19137907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 515 - 562
Target Start/End: Original strand, 39040980 - 39041027
Alignment:
| Q |
515 |
gtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
39040980 |
gtgtcatttgatccatgtagccgaccccacttaatgggataagacttg |
39041027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 9400731 - 9400793
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||| ||||||||||||| |||||||||| |||||||| | ||||||| |
|
|
| T |
9400731 |
tatggcgtcatttgatccaggtagccgaccccatttagtgggattaggcttggttattgttgt |
9400793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 554
Target Start/End: Complemental strand, 41833730 - 41833676
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggat |
554 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
41833730 |
tgatagaacattttggtgtaatttaatccatgtagctgaccccgcttagtgggat |
41833676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 79722 - 79795
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| || |||| ||||||||||| | ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
79722 |
tgatagaccattatggcgtgatttcatccatgtagctggccccacttagtgggaaaaggcttggtggttgttgt |
79795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 562
Target Start/End: Complemental strand, 3448817 - 3448776
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
3448817 |
tttgatccatgttgccgaccccactgagtgggataaggcttg |
3448776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 534 - 575
Target Start/End: Complemental strand, 10124427 - 10124386
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10124427 |
gccgaacccacttagtgggataaggcttggttgttgttgtag |
10124386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 570
Target Start/End: Complemental strand, 11002473 - 11002424
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||||||||| |||||| |
|
|
| T |
11002473 |
tttgattcatgtagtcgaccctacttagtgggataaggcttggttgttgt |
11002424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 502 - 563
Target Start/End: Original strand, 12534423 - 12534484
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||| ||||||| ||||||||||| ||||||| |
|
|
| T |
12534423 |
atagaacattatggcgtaatttgatccatttagttgaccccagttagtgggatacggcttgg |
12534484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 24178739 - 24178792
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
24178739 |
atttgatctatgtagccgaccccacttaatgaaataaggcttggttgttgttgt |
24178792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 27998650 - 27998723
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| || ||||||||||||| ||||||||||||||||||||| || |||| || |||||| |
|
|
| T |
27998650 |
tgatagaatattatgacgtcgtttgatccatgtaaccgaccccacttagtgggatatggtttggttgatgttgt |
27998723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 32006220 - 32006163
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccactt-agtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| | |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
32006220 |
gtaatttgatccatgtagccaaacccagttcagtgggataaggcttggttgttgttgt |
32006163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 538 - 575
Target Start/End: Original strand, 32489293 - 32489330
Alignment:
| Q |
538 |
accccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32489293 |
accccacttagtgggataaggcttggttgttgttgtag |
32489330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 36123255 - 36123182
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| || |||||||||||||||||| ||||| ||||||||| |
|
|
| T |
36123255 |
tgatagaacattatggtggcgtttgatccatgtaatcggtcccacttagtgggataagacttggttgttgttgt |
36123182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 502 - 562
Target Start/End: Original strand, 2393088 - 2393148
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||| | |||||| | ||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
2393088 |
atagaatactatggtatcatttgatccatgtagccgatcccacttaatgggataaagcttg |
2393148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 525 - 573
Target Start/End: Original strand, 5303681 - 5303729
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||| ||||||||| |
|
|
| T |
5303681 |
atccatgtagccgatcccacttagtgggataagtcctggttgttgttgt |
5303729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 529 - 573
Target Start/End: Original strand, 21952600 - 21952644
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| |||||| || ||||||||| |
|
|
| T |
21952600 |
atgtagccgaccccacttagtgggaaaaggctcggttgttgttgt |
21952644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 516 - 572
Target Start/End: Original strand, 25938194 - 25938250
Alignment:
| Q |
516 |
tgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||||| |||||| ||||| |||||||| |
|
|
| T |
25938194 |
tgtaatttgattcatgtagccgactccacatagtgagataagacttggttgttgttg |
25938250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 537 - 573
Target Start/End: Original strand, 29929300 - 29929336
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29929300 |
gaccccacttagtgggataaggcttggttgttgttgt |
29929336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 530 - 562
Target Start/End: Original strand, 34119859 - 34119891
Alignment:
| Q |
530 |
tgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34119859 |
tgtagccgaccccacttagtgggataaggcttg |
34119891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 21193707 - 21193652
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| |||||| |||||||||| |||||| ||||||||||| | ||||||| |
|
|
| T |
21193707 |
taatttgattcatgtatccgaccccacgtagtggaataaggcttggttattgttgt |
21193652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 509 - 572
Target Start/End: Original strand, 39766739 - 39766802
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||| ||||||| |||||||||||||||| |||||| || || |||| |||| |||||||| |
|
|
| T |
39766739 |
attatggcgtaattttatccatgtagccgacctcacttactgagaaaagggttggttgttgttg |
39766802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 515 - 562
Target Start/End: Complemental strand, 40265519 - 40265472
Alignment:
| Q |
515 |
gtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||||| ||||||||||||| |
|
|
| T |
40265519 |
gtgtaatttgatccatatagtcgactccacttagggggataaggcttg |
40265472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 520 - 570
Target Start/End: Original strand, 2049290 - 2049339
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
2049290 |
atttgatccatgtagccgactgcactta-tgggataaggcttggttgttgt |
2049339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 520 - 562
Target Start/End: Complemental strand, 24391077 - 24391035
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
24391077 |
atttaatccaagtagcagaccccacttagtgggataaggcttg |
24391035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 509 - 555
Target Start/End: Complemental strand, 30288643 - 30288597
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
30288643 |
attatggtgtaatttgatctatgtagccaaccatacttagtgggata |
30288597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 502 - 556
Target Start/End: Original strand, 30588658 - 30588712
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
|||||| |||||| || || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
30588658 |
atagaacattatgacgtgatatgatccatgtagccgactccacttagtgggataa |
30588712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 571
Target Start/End: Complemental strand, 30639351 - 30639301
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||||||| | |||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
30639351 |
tttgatccatgtagtcaaccctacttagtgggataagacttggttgttgtt |
30639301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 571
Target Start/End: Original strand, 33667665 - 33667715
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||| | ||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
33667665 |
tttgattcgtgtagccaaccccacttattgggataaggcttggttgttgtt |
33667715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 562
Target Start/End: Original strand, 1935423 - 1935464
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
1935423 |
tttgattcatatagccgaccccacttagtggaataaggcttg |
1935464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 509 - 574
Target Start/End: Original strand, 3292737 - 3292802
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| | ||||||||||||||| || |||| ||||||||||| ||||| || |||||||||| |
|
|
| T |
3292737 |
attatggcgcaatttgatccatgtatccaacccaacttagtgggaaaaggcctgattgttgttgta |
3292802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 528 - 573
Target Start/End: Complemental strand, 3775119 - 3775074
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||| || || ||||||||| |
|
|
| T |
3775119 |
catgtagccgaccccacttagtgggataaagcctgattgttgttgt |
3775074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 549
Target Start/End: Original strand, 6788276 - 6788325
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagt |
549 |
Q |
| |
|
|||||||| ||||| | |||||||||| ||||||||||||| |||||||| |
|
|
| T |
6788276 |
tgatagaacattatagcgtaatttgattcatgtagccgacctcacttagt |
6788325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 534 - 571
Target Start/End: Original strand, 10668648 - 10668685
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
10668648 |
gccgaccccacttattgggataaggcttggttgttgtt |
10668685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 524 - 573
Target Start/End: Original strand, 34273246 - 34273295
Alignment:
| Q |
524 |
gatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||||||| | ||||||||| |
|
|
| T |
34273246 |
gatccatgtagccaacctcacttagtgagataaggcttagttgttgttgt |
34273295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 518 - 550
Target Start/End: Complemental strand, 1001238 - 1001206
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtg |
550 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
1001238 |
taatttgatccatgtagccgaccccatttagtg |
1001206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 4026380 - 4026328
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||| ||||||||| |
|
|
| T |
4026380 |
tttgatccatgtagccgagttcactttgtgggatcaggcttggttgttgttgt |
4026328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 18350954 - 18350902
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||| || ||||| ||||||||| |
|
|
| T |
18350954 |
tttgatccatgtagccgacctcacatggtgggatgagacttggatgttgttgt |
18350902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 503 - 555
Target Start/End: Original strand, 29938322 - 29938374
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
||||| ||| |||||||| ||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
29938322 |
tagaacattttggtgtaagttggtccatgtagccgaccccactcagttggata |
29938374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 538 - 570
Target Start/End: Complemental strand, 34191003 - 34190971
Alignment:
| Q |
538 |
accccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
34191003 |
accccacttagtgggataaggcttggttgttgt |
34190971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 5e-24; HSPs: 179)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 28236391 - 28236464
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
28236391 |
tgatagaatattatggtgtaatttgatctatgtagccgaccccacttagtgggataagacttggttgttgttgt |
28236464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 45209278 - 45209205
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45209278 |
tgatagaatattatggcgtagtttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
45209205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 26024923 - 26024851
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
26024923 |
tgatagaacattatggtgtaattttatccatgtagccgacctcacttagtgggataaggcttggttgttgttg |
26024851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 21528495 - 21528570
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21528495 |
tttgatagaacactatggtggcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
21528570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 507 - 573
Target Start/End: Complemental strand, 30634172 - 30634106
Alignment:
| Q |
507 |
aaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30634172 |
aaataatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
30634106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 25575033 - 25575106
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
25575033 |
tgatagaacattgtggtgtaatttgatccatgtagcagaccccatttagtgggataaggcttggttgttgttgt |
25575106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 31959887 - 31959814
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31959887 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
31959814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 35690480 - 35690553
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
35690480 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataagacttggtttttgttgt |
35690553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 569
Target Start/End: Complemental strand, 36255595 - 36255526
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
36255595 |
tgatagaacattatggtgtaatttgatccatgtggccgaccccacttagtgggaaaaggcttggttgttg |
36255526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 52569588 - 52569515
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52569588 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
52569515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 55007955 - 55008028
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55007955 |
tgatagatcattatgacgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
55008028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 27450255 - 27450179
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
27450255 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgctgttgta |
27450179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 498 - 570
Target Start/End: Complemental strand, 37042739 - 37042667
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
37042739 |
tttgatagaacattatggtgtcgtttgatccatgtagccgacccgacttagtgggataaggcttggttgttgt |
37042667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 502 - 573
Target Start/End: Complemental strand, 39100607 - 39100536
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||| ||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39100607 |
atagaacattatggcgtaatataatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
39100536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 49939809 - 49939734
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || ||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
49939809 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttgttgttgt |
49939734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 55388284 - 55388213
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55388284 |
tgatagaacattgtggtgtaatttgatccatgttgtcgaccccacttagtgggataaggcttggttgttgtt |
55388213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 23906370 - 23906296
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23906370 |
tgatagaacactatggcgtcatttgatccatgtagctgaccccacttagtgggataaggcttggttgttgttgta |
23906296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 48622616 - 48622542
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | ||||| || |||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48622616 |
tgatagaacactatggcgtcatttaatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
48622542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 50238677 - 50238615
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50238677 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
50238615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 50238763 - 50238701
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50238763 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
50238701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 514 - 568
Target Start/End: Original strand, 50862854 - 50862908
Alignment:
| Q |
514 |
ggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50862854 |
ggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgtt |
50862908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 436458 - 436511
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
436458 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
436511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 1777090 - 1777017
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
1777090 |
tgatagaacagtatggcgtcatttgatccatgtagccgaccccacttaatgggataaggcttggttgttgttgt |
1777017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 13805338 - 13805265
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
13805338 |
tgatagaacattatgggataatttgatccatgtagccaaccccacttagtgggatatggcttggttgttgttgt |
13805265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 509 - 570
Target Start/End: Complemental strand, 15661936 - 15661875
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
15661936 |
attatggcgtaatttgatccatgtagccgaccccacttagtgggataaggtttggttgttgt |
15661875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 19062008 - 19061935
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
19062008 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacctagtgggataaggcttggttgttgttgt |
19061935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 28351788 - 28351841
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28351788 |
atttgatccatgtagccgaccccacttagtggggtaaggcttggctgttgttgt |
28351841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 29399013 - 29399086
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||| |||||||| ||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
29399013 |
tgatagaacattatggcgtaatttgattcatgtagctgaccccacttagtgggaaaaggcttggttgttgttgt |
29399086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 37488300 - 37488373
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37488300 |
tgatagagcattatggcgtaatttgatccatgtagccagccccacttagtgggataaggcttggttgttgttgt |
37488373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 47265268 - 47265195
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||| |||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||| |
|
|
| T |
47265268 |
tgatagaacactatagtgtaatttgatccatgtagccgacctcacttagtgggataaggcttggttattgttgt |
47265195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 48174166 - 48174093
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||| || |||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48174166 |
tgataaaacattatggcgtcatttgatccatgtagcagaccccacttagtgggataaggcttggttgttgttgt |
48174093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 516 - 568
Target Start/End: Original strand, 7947162 - 7947214
Alignment:
| Q |
516 |
tgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7947162 |
tgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgtt |
7947214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 15665327 - 15665383
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15665327 |
gtaatttgatccatgtagctgaccccacttagtgggataaggcttggttgttgttgt |
15665383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 26037578 - 26037506
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| | ||||| |||||| ||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
26037578 |
tgatagaacactatggcgtaattggatccatgtagccgaccccacttagtgggataaggtttggttgttgttg |
26037506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 32479245 - 32479320
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
32479245 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtggaaaaaggcttggttgttgttgt |
32479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 2557745 - 2557671
Alignment:
| Q |
500 |
tgatagaaaattat-ggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| || ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
2557745 |
tgatagaacattattggtgtaatttgatccatgtagccaactccatttagtgggataaggcttggttgttgttgt |
2557671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 508 - 573
Target Start/End: Complemental strand, 4879175 - 4879109
Alignment:
| Q |
508 |
aattatggt-gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
4879175 |
aattatggttgtaatttgatccatgtagccgacctcacttactgggataaggcttggttgttgttgt |
4879109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 19969401 - 19969463
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
19969401 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttgttgttgt |
19969463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 523 - 573
Target Start/End: Original strand, 46153940 - 46153990
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46153940 |
tgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
46153990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 561
Target Start/End: Original strand, 4441062 - 4441123
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4441062 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctt |
4441123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 6957827 - 6957880
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
6957827 |
atttgatccatgtagccgatcccacttagtgggataaggcttggttgttgttgt |
6957880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 8286668 - 8286721
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8286668 |
atttgatccatgtagccgcccccacttagtgggataaggcttggttgttgttgt |
8286721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 19154936 - 19154863
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||| ||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19154936 |
tgatagaacactatggcgttatttgatccatgcagctgaccccacttagtgggataaggcttggttgttgttgt |
19154863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 509 - 574
Target Start/End: Original strand, 28348275 - 28348340
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| |||| ||||| |||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
28348275 |
attatgatgtactttgaaccatgtagccgaccccgcttagtgggataaggcttggttgttgttgta |
28348340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 521 - 574
Target Start/End: Complemental strand, 49738602 - 49738549
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
49738602 |
tttgatccatgtagccgaccccatttagtgggataaggcttggttgttgttgta |
49738549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 504 - 573
Target Start/End: Complemental strand, 50967097 - 50967028
Alignment:
| Q |
504 |
agaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||| |||| |||||| ||||||||| |
|
|
| T |
50967097 |
agaaaattatgtcgtaatttgatccatgtagccgacctcacttagtggaataaagcttggttgttgttgt |
50967028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 3979129 - 3979201
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||| || |||| |||||||||||||||||| |||||||| |
|
|
| T |
3979129 |
tgatagaacattatgacgtaatttgatccatgtagcctactccacatagtgggataaggcttggttgttgttg |
3979201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 509 - 561
Target Start/End: Complemental strand, 11400509 - 11400457
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11400509 |
attatggtgtaatttcatccatgtagccgacccaacttagtgggataaggctt |
11400457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 509 - 561
Target Start/End: Complemental strand, 11410236 - 11410184
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11410236 |
attatggtgtaatttcatccatgtagccgacccaacttagtgggataaggctt |
11410184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 44719425 - 44719361
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
44719425 |
attatggtgtcgtttgatccatgtagccgaccctacttagtgggataagacttggttgttgttgt |
44719361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 51438663 - 51438727
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
51438663 |
attatggcgtaatttgatccatgtagctgacccaactttgtgggataaggcttggttgttgttgt |
51438727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 525 - 573
Target Start/End: Original strand, 56130404 - 56130452
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
56130404 |
atccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
56130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 32633481 - 32633406
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || ||||||| ||||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
32633481 |
tttgatagaacactatggcgtcatttgatacatgtagccaaccccacttagtgggaaaaggcttggttgttgttgt |
32633406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 511 - 574
Target Start/End: Original strand, 46236709 - 46236772
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
46236709 |
tatggcgtactttgatccatgtagccgaccccacttagtaggataaggcttggtggttgttgta |
46236772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 516 - 574
Target Start/End: Original strand, 813143 - 813201
Alignment:
| Q |
516 |
tgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
813143 |
tgtaatttgatccatgtagcagaccccgcttagtggaataaggcttggttgttgttgta |
813201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 509 - 571
Target Start/End: Complemental strand, 21359289 - 21359227
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
21359289 |
attatggcgtaatttgattcatgcagccgaccccacttagtgggataaggctttgttgttgtt |
21359227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 31459203 - 31459273
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||| ||| ||||||| | || |||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31459203 |
tgattgaacattatggcggaacttgatccatgtacccgaccccacttagtgggataaggcttggttgttgt |
31459273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 12494892 - 12494945
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12494892 |
atttaatccatgtagcggaccccacttagtgggataaggcttggttgttgttgt |
12494945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 21237067 - 21237140
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||| ||||||||| ||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
21237067 |
tgatagaacactatggcgtcatttgatacatgtagccaaccccacttagtgggataaggattggttgttgttgt |
21237140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 34208342 - 34208269
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| | ||||||||||||||| ||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
34208342 |
tgatagaacattatggcgcaatttgatccatgtactcgaccccccttattgggataaggcttggttgttgttgt |
34208269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 521 - 574
Target Start/End: Original strand, 38017319 - 38017372
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||| |||||||||| |
|
|
| T |
38017319 |
tttgatccatgtagccgatcctacttagtgggataaggcttgggtgttgttgta |
38017372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 43434153 - 43434206
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
43434153 |
atttgatccatgtagtcgagcccacttagtgggataaggcttggttgttgttgt |
43434206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 45204912 - 45204840
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||| || ||||||||||| |||||||| |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
45204912 |
tgatagaacatta-ggcgtaatttgatctatgtagcccacccaacttagtgggataaggcttggttgttgttgt |
45204840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 51421939 - 51422012
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||| | | ||||||||||||||| |||||| ||||||||| |
|
|
| T |
51421939 |
tgatagaacattatgacgtaatttgatccatgtagccaatctcacttagtgggataaagcttggttgttgttgt |
51422012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 56375519 - 56375572
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
56375519 |
atttgatccatgtagccgacctcacttagtgggataagacttggttgttgttgt |
56375572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 4548231 - 4548303
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| | || || |||||||||||||||||||| |||| |||||||||||||| |||||| |||||||| |
|
|
| T |
4548231 |
tgatagaacactaaggcgtaatttgatccatgtagccaacccaacttagtgggataatgcttggttgttgttg |
4548303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 5306514 - 5306578
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||||||||| |||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
5306514 |
attatggcgtaatttgatccatatagctaaccccacttggtgggataaggcttggttgttgttgt |
5306578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 519 - 563
Target Start/End: Complemental strand, 7544585 - 7544541
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7544585 |
aatttgatccatgtagccgaccccacttagtgggataagccttgg |
7544541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 28550530 - 28550454
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||| |||| | |||||||||| ||||||| ||||||||||| |||||||||| |||| |||||||||| |
|
|
| T |
28550530 |
tttgatagaaagctatgttataatttgatcaatgtagctgaccccacttattgggataaggtttggttgttgttgta |
28550454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 31961318 - 31961266
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
31961318 |
tttgattcatgtagccgacctcacttagtgggataaggcttggttgttgttgt |
31961266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 500 - 576
Target Start/End: Original strand, 49686902 - 49686978
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
|||| ||| ||||||| || ||||| ||||||||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
49686902 |
tgatggaatattatggcgtcgtttgaaccatgtagccgaccccacttagtgggataagacttggttgttgctgtagt |
49686978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 571
Target Start/End: Original strand, 1095654 - 1095725
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||| || |||||||| ||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1095654 |
tgatagaacattatggcgttatttgatcgatgtacccgaccccgtttagtgggataaggcttggttgttgtt |
1095725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 514 - 573
Target Start/End: Complemental strand, 25427921 - 25427862
Alignment:
| Q |
514 |
ggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || |||||| ||||| ||||||||| |
|
|
| T |
25427921 |
ggtgtaatttgatccatgtaaccgaccccacttaatgagataagacttggttgttgttgt |
25427862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 571
Target Start/End: Original strand, 34585691 - 34585762
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||| || ||||||| || |||||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
34585691 |
tgataaaacattatggcgtcatttgatccatgtagcttaacccacttagtgggataaggcttggttgttgtt |
34585762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 563
Target Start/End: Original strand, 39708642 - 39708705
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
39708642 |
tgatagaacactatgtcgtaatttgatccatgtagtcgaccccacttagtgggataagacttgg |
39708705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 523 - 574
Target Start/End: Original strand, 47372936 - 47372987
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
47372936 |
tgatccatgtagccgaccctacttagtgggataaggcttgattgttgttgta |
47372987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 502 - 573
Target Start/End: Original strand, 56225279 - 56225350
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | |||| ||||||||||||||||| | ||||||||||||||||||||||| | || ||||||||| |
|
|
| T |
56225279 |
atagaacactatgatgtaatttgatccatgtggtcgaccccacttagtgggataaggatcggttgttgttgt |
56225350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 519 - 573
Target Start/End: Complemental strand, 1211446 - 1211392
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
1211446 |
aatttgattcatgtagccgaccccacttaatgggataagacttggttgttgttgt |
1211392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 508 - 573
Target Start/End: Complemental strand, 1328680 - 1328614
Alignment:
| Q |
508 |
aattatggtg-taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| || || |||||||||||||||||| ||||||||| |
|
|
| T |
1328680 |
aattatggtggtaatttgatccatgtatccgatcctacctagtgggataaggcttggttgttgttgt |
1328614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 517 - 571
Target Start/End: Complemental strand, 45184189 - 45184135
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
45184189 |
gtaattcgattcatgtagccgaccccacttagtgggataaggcttagttgttgtt |
45184135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 7066552 - 7066499
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
7066552 |
atttgattcatgtagctgaccccatttagtgggataaggcttggttgttgttgt |
7066499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 12443304 - 12443377
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| |||| | || ||||||||||||| ||||||||| |
|
|
| T |
12443304 |
tgatagaacattatggcataatttgatccatgtagccgatcccaaatcgtaggataaggcttggttgttgttgt |
12443377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 22420790 - 22420717
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| || ||||||| |||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22420790 |
tgatagagcattatggcgttgtttgatctatgtagttgaccccacttagtgggataaggcttggttgttgttgt |
22420717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 32339768 - 32339841
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| | | | ||||||||||||||||||||| ||||||||| |
|
|
| T |
32339768 |
tgatagaaaattatggcgtcgtttgatccatgtagtctattctacttagtgggataaggcttggttgttgttgt |
32339841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 33190901 - 33190848
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
33190901 |
atttgacccatgtagccgaccccacctagtgggataaggcttggttgtttttgt |
33190848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 40932997 - 40932924
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| | |||||| ||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
40932997 |
tgatagaacattatggcggcgtttgatgcatgtagccgaccccacttggtgggataaggcttgattgttgttgt |
40932924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 533 - 574
Target Start/End: Original strand, 49416949 - 49416990
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49416949 |
agccgaccccacttagtgggataaggcttggttgttgttgta |
49416990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 574
Target Start/End: Original strand, 50471757 - 50471810
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
50471757 |
tttgatccatgtaatcgaccccacttagtgggataacgcttggttgttgttgta |
50471810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 53540499 - 53540572
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||| |||||||| ||||||||||| ||||| |||| |||| |
|
|
| T |
53540499 |
tgatagaacattatggcataatttgatccatatagccaaccccactgagtgggataagacttggttgttattgt |
53540572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 569
Target Start/End: Original strand, 54470436 - 54470485
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
54470436 |
atttgatccatgtagccaaccccacttagtgggattaggcttggttgttg |
54470485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 533 - 573
Target Start/End: Original strand, 8327143 - 8327183
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8327143 |
agccgaccccacttagtgggataaggcttggttgttgttgt |
8327183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 518 - 574
Target Start/End: Complemental strand, 36799712 - 36799656
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
36799712 |
taatttgatccatgtagacgaccccacttagtgggataaagcttaattgttgttgta |
36799656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 44047422 - 44047370
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
44047422 |
tttgattcatgtagccaaccccacttagtgggatatggcttggttgttgttgt |
44047370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 50869932 - 50869880
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50869932 |
tttgattcatgcagctgaccccacttagtgggataaggcttggttgttgttgt |
50869880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 498 - 562
Target Start/End: Complemental strand, 51811353 - 51811290
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||||| | |||| || ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51811353 |
tttgatagaacactatgacgtcatttgatccatgtagccga-cccacttagtgggataaggcttg |
51811290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 518 - 574
Target Start/End: Original strand, 54529645 - 54529701
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
54529645 |
taatttgatccatgtagccggacccatttagtgggataagacttggttgttgttgta |
54529701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 2589279 - 2589354
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||| |||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
2589279 |
tttgatagaacactatggcgtcgtttgattcatgtagctaaccccagttagtgggataaggcttggttgttgttgt |
2589354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 498 - 557
Target Start/End: Complemental strand, 8599016 - 8598957
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||||| ||||||| || |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
8599016 |
tttgatagaacattatggcgtcgtttgattcatgtagccgacgccacttagtgggataag |
8598957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 22873672 - 22873609
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| ||||| ||||||| |||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
22873672 |
tgatagaacattataacgtaatttaatccatgtagccaaccccatttagtgggataaggcttgg |
22873609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 518 - 573
Target Start/End: Complemental strand, 26275071 - 26275016
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||| ||||||||| ||||||||| |
|
|
| T |
26275071 |
taatttgatccatgtatccgaccccatttagttggaaaaggcttggttgttgttgt |
26275016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 502 - 553
Target Start/End: Original strand, 28467649 - 28467700
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
28467649 |
atagaacattatggcgtaatttgatccatgtagcggaccccgcttagtggga |
28467700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 518 - 569
Target Start/End: Complemental strand, 52360014 - 52359963
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| |||||||||| ||||| |
|
|
| T |
52360014 |
taatttgatccatgtagcagaccccactttgtggggtaaggcttggttgttg |
52359963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 559
Target Start/End: Original strand, 1380600 - 1380638
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggc |
559 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1380600 |
tttgatccatgtagccgacctcacttagtgggataaggc |
1380638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 29209248 - 29209174
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| ||||||| || ||||||| ||||||||||||||||||| ||||||||| ||||| |||| ||||| |
|
|
| T |
29209248 |
tgatagagcattatggcgttgtttgatcaatgtagccgaccccacttaatgggataagacttggttgtttttgta |
29209174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 562
Target Start/End: Original strand, 31339733 - 31339795
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||| |||||| || |||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31339733 |
tgatagaacattatgacgtcgtttggtccatgtatccgaccccacttagtgggataaggcttg |
31339795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 31403107 - 31403033
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| |||||||||||||| |||||| ||||| |||||||||| |
|
|
| T |
31403107 |
tgatagagcattatggtgttgcttgatccatgtagacgaccccacttagtaggataaaacttggttgttgttgta |
31403033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 503 - 573
Target Start/End: Complemental strand, 38809669 - 38809599
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||| || |||||||||| ||||| |||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
38809669 |
tagaacattatggcatattttgatccatatagccaaccccacttaatgggataagacttcgctgttgttgt |
38809599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 46582887 - 46582826
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||||||||||||| |||| ||||||| ||||||||||||| ||||||||| |
|
|
| T |
46582887 |
tatggcgtcatttgatccatgtagcctaccc-acttagtaggataaggcttggttgttgttgt |
46582826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 27983422 - 27983475
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| |||| ||| |||||||||| |||| ||||||||| |
|
|
| T |
27983422 |
atttgatccatgtagccgatcccaattaatgggataaggtttggttgttgttgt |
27983475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 574
Target Start/End: Complemental strand, 31897480 - 31897427
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
31897480 |
tttgattcatgtagccaacctcacttagtgggataaggctcggttgttgttgta |
31897427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 525 - 570
Target Start/End: Complemental strand, 32630540 - 32630495
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
32630540 |
atccatgtagctgaccccacttagtgggataaggctcggttgttgt |
32630495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 33227438 - 33227491
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| ||||||||||| |||| |||| |
|
|
| T |
33227438 |
atttgatccatgtagccgatcccacctagtggaataaggcttggttgtttttgt |
33227491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 37798080 - 37798133
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| | ||||||| |
|
|
| T |
37798080 |
atttgatcaatgtagccgactccatttagtgggataaggcttggttattgttgt |
37798133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 524 - 573
Target Start/End: Original strand, 41192294 - 41192343
Alignment:
| Q |
524 |
gatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||||||||| ||||||||| |
|
|
| T |
41192294 |
gatccatgtagccgacccgacatagttggataaggcttggttgttgttgt |
41192343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 574
Target Start/End: Original strand, 46372254 - 46372307
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| |||||||| ||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
46372254 |
tttgattcatgtagctgaccccacttagttgggtaaggcttggttgttgttgta |
46372307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 516 - 573
Target Start/End: Complemental strand, 46539168 - 46539111
Alignment:
| Q |
516 |
tgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
46539168 |
tgtaatttgattcatgtaggcaaccccacttagtgggataaggtttgcttgttgttgt |
46539111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 529 - 573
Target Start/End: Complemental strand, 6478706 - 6478663
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
6478706 |
atgtagccgaccc-acttagtgggataaggcttggttgttgttgt |
6478663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 569
Target Start/End: Original strand, 10209264 - 10209312
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
10209264 |
tttgattcaagtagccgaccccacttagtgggataaggcgtggttgttg |
10209312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 498 - 570
Target Start/End: Original strand, 13262419 - 13262491
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||| |||| || |||||| |||||||||||| |||||||||| |||||||||| | |||||| |
|
|
| T |
13262419 |
tttgatagaaaactatgacgtcgtttgattcatgtagccgactccacttagtgtgataaggcttagttgttgt |
13262491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 527 - 571
Target Start/End: Original strand, 20047670 - 20047714
Alignment:
| Q |
527 |
ccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
20047670 |
ccatgtagccggccccacttagtgggataagacttggttgttgtt |
20047714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 502 - 574
Target Start/End: Original strand, 25755527 - 25755599
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||| ||||| |||| |||||||||||| || ||| |||| ||| ||||||||||||||| |||| ||||| |
|
|
| T |
25755527 |
atagaacattatagtgtcatttgatccatgaagtcgatcccatttaatgggataaggcttggttgtttttgta |
25755599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 534 - 570
Target Start/End: Original strand, 32745831 - 32745867
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32745831 |
gccgaccccacttagtgggataaggcttggttgttgt |
32745867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 35622728 - 35622676
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35622728 |
tttgattcaggtagctgaccccacttagtgggataaggcttggtcgttgttgt |
35622676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 509 - 561
Target Start/End: Complemental strand, 38585315 - 38585263
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||||| |||||||||||||| |||| || |||||||||||| ||||||||| |
|
|
| T |
38585315 |
attatggcgtaatttgatccatttagctgagcccacttagtggaataaggctt |
38585263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 500 - 556
Target Start/End: Complemental strand, 40018262 - 40018206
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
|||||||| |||| || || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40018262 |
tgatagaacattacggcgtcgtttgatccatgtagccgaccccacttagtggaataa |
40018206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 42285755 - 42285703
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||| |||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
42285755 |
tttgattcatgtagccaaccccacttagttggataagacttggttgttgttgt |
42285703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 509 - 569
Target Start/End: Original strand, 53517723 - 53517783
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| ||||||||| ||||| ||||| ||||| |
|
|
| T |
53517723 |
attatggtgtcgtttaatccatgtagccgaccctacttagtggaataagacttggttgttg |
53517783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 53518396 - 53518325
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||| ||| ||||||||||||||||||| | || || |||||||| |
|
|
| T |
53518396 |
tgatagaacactatggcgtaatttgatccatgcagc-gaccccacttagtgggataggactcggttgttgttg |
53518325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 572
Target Start/End: Complemental strand, 4136795 - 4136744
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||| ||||| |||||||| |
|
|
| T |
4136795 |
tttgatccatgtagccgaccctacttagtgagataaaacttggttgttgttg |
4136744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 543 - 574
Target Start/End: Complemental strand, 8289021 - 8288990
Alignment:
| Q |
543 |
acttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8289021 |
acttagtgggataaggcttggctgttgttgta |
8288990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 524 - 571
Target Start/End: Complemental strand, 8459103 - 8459056
Alignment:
| Q |
524 |
gatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
8459103 |
gatccatgtagccaaccccatttagtgggataagacttggttgttgtt |
8459056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 532 - 563
Target Start/End: Original strand, 10536580 - 10536611
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10536580 |
tagccgaccccacttagtgggataaggcttgg |
10536611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 509 - 560
Target Start/End: Complemental strand, 14623294 - 14623243
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggct |
560 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||| |||||| |||||||| |
|
|
| T |
14623294 |
attatggtgtcatttgatccatgtagccaatcccacctagtggaataaggct |
14623243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 500 - 563
Target Start/End: Complemental strand, 34233097 - 34233034
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| ||| | | ||||||||||||||||||||||| ||||| ||||||| || |||||| |
|
|
| T |
34233097 |
tgatagaacattgtagcgtaatttgatccatgtagccgacgccactcagtgggacaatgcttgg |
34233034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 539 - 574
Target Start/End: Complemental strand, 38789657 - 38789622
Alignment:
| Q |
539 |
ccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38789657 |
ccccacttagtgggataaggcttggttgttgttgta |
38789622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 538 - 573
Target Start/End: Complemental strand, 49454514 - 49454479
Alignment:
| Q |
538 |
accccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49454514 |
accccacttagtgggataaggcttggttgttgttgt |
49454479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 518 - 573
Target Start/End: Original strand, 54935376 - 54935431
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||| | ||||||| |||| |||| |
|
|
| T |
54935376 |
taatttgatccatgtagcctaccccacttggtgggacagggcttggttgttattgt |
54935431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 562
Target Start/End: Original strand, 8284348 - 8284410
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||||| ||||||| || ||||||||||| ||||||| || |||||||||||| ||||||| |
|
|
| T |
8284348 |
tgatagatcattatggcgtcatttgatccatatagccgatcctacttagtgggattaggcttg |
8284410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 529 - 571
Target Start/End: Complemental strand, 10775515 - 10775473
Alignment:
| Q |
529 |
atgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
10775515 |
atgtcgccgaccccacatagtgggataaggcttggttgttgtt |
10775473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 571
Target Start/End: Original strand, 17900710 - 17900760
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||| ||| |||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
17900710 |
tttgattcatttagctgaccccacttagtgggataaggcttgattgttgtt |
17900760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 20192242 - 20192311
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| |||||| || |||||||| | ||||||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
20192242 |
tgatagaacattatgacgttatttgatcaa-gtagccgaccctacttagtgggataaagcttggttgttgt |
20192311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 539 - 573
Target Start/End: Original strand, 26357007 - 26357041
Alignment:
| Q |
539 |
ccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26357007 |
ccccacttagtgggataaggcttggttgttgttgt |
26357041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 539 - 573
Target Start/End: Complemental strand, 26772571 - 26772537
Alignment:
| Q |
539 |
ccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26772571 |
ccccacttagtgggataaggcttggttgttgttgt |
26772537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 528 - 574
Target Start/End: Complemental strand, 28764419 - 28764373
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||| || || |||||||||||||||| |||||||||| |
|
|
| T |
28764419 |
catgtagccgacctcatttggtgggataaggcttggttgttgttgta |
28764373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 29801588 - 29801658
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||| ||||||||||| || ||||||||||||||| |||| |||| |||| |||||| ||| |||||||| |
|
|
| T |
29801588 |
tgattgaaaattatggcgtcgtttgatccatgtagctgacctcactcagtgagataagactttgctgttgt |
29801658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 49987617 - 49987691
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| ||||||| ||||||| |||| | ||| ||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
49987617 |
tgatagagcattatggcgtaattttatccttctagttgaccccacttagttggataaggtttggttgttgttgta |
49987691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 501 - 551
Target Start/End: Original strand, 51176784 - 51176834
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgg |
551 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
51176784 |
gatagaacattatggcataatttgatccatgtagcggaccacacttagtgg |
51176834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 509 - 555
Target Start/End: Original strand, 55579249 - 55579295
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
55579249 |
attatgatataatttgatccatgtagccaaccccacttagtgtgata |
55579295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 56439644 - 56439570
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggc-tgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| | ||||||| |||||| ||||| ||||||||||||| || ||||||| || ||||||||| |
|
|
| T |
56439644 |
tgatagaacattatagcgtaatttaatccatatagccaaccccacttagtgcgaaaaggctttgcttgttgttgt |
56439570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 526 - 563
Target Start/End: Complemental strand, 934478 - 934441
Alignment:
| Q |
526 |
tccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
934478 |
tccatgtagccgaccccacttagatggataaggcttgg |
934441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 517 - 570
Target Start/End: Original strand, 1793688 - 1793741
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||| |||||||||| | |||||| |
|
|
| T |
1793688 |
gtaatttgattcatgtagccgatctcacttagtgagataaggcttagttgttgt |
1793741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 553
Target Start/End: Complemental strand, 1965706 - 1965653
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
|||||||| | ||||| ||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
1965706 |
tgatagaataatatggcgtaatttgatccacgtagccgatcccatttagtggga |
1965653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 517 - 570
Target Start/End: Original strand, 13296659 - 13296712
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||| || |||||| |||||| |
|
|
| T |
13296659 |
gtaatttgatgcatgcagccgacctcacttagtgggaaaatgcttggttgttgt |
13296712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 16875825 - 16875752
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||| |||||||||| |||| | |||| ||| ||||||||| |
|
|
| T |
16875825 |
tgatagaacattattatgtaacttgatccatgtagcagaccccactttgtggaaaaaggtttgattgttgttgt |
16875752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 20105591 - 20105518
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | ||||||| || ||||||||||||||||| | | |||||||| ||| ||||||||| |||||||| |
|
|
| T |
20105591 |
tgataggacattatggcgtcatttgatccatgtagccaatctcacttagtaggacaaggcttggtggttgttgt |
20105518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 557
Target Start/End: Complemental strand, 20601725 - 20601668
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||||||| |||||| |||||||||| |||||| | || |||||||||||||||||| |
|
|
| T |
20601725 |
tgatagaacattatgacgtaatttgattcatgtaactgaacccacttagtgggataag |
20601668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 562
Target Start/End: Original strand, 20999230 - 20999271
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||| ||||| |
|
|
| T |
20999230 |
tttgatccttgtagccgaccccactcagtgggataaagcttg |
20999271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 561
Target Start/End: Complemental strand, 21879202 - 21879161
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
||||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
21879202 |
atttggtccatgtcgccgactccacttagtgggataaggctt |
21879161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 553
Target Start/End: Complemental strand, 22241309 - 22241256
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||||||||| |||| |||||||| |
|
|
| T |
22241309 |
tgatagagaattatggtgtcgtttgaaccatgtagccgactccacctagtggga |
22241256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 23294023 - 23294064
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
23294023 |
tagccgaccctacttagtgggataaggcgtggttgttgttgt |
23294064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 25959280 - 25959227
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| ||||||| ||| ||| |||||||||||| ||||| ||||||||| |
|
|
| T |
25959280 |
atttgatccttgtagccaacctcacctagtgggataagacttggttgttgttgt |
25959227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 27338460 - 27338387
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| ||| || |||||||||||||||||| ||||||||||| || ||| | ||||||||| |
|
|
| T |
27338460 |
tgatagaacattatgacgtagttggatccatgtagccgaccctccttagtgggatgagactttgttgttgttgt |
27338387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 523 - 556
Target Start/End: Original strand, 34809254 - 34809287
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
34809254 |
tgatccatgtagccgaccccacttagcgggataa |
34809287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 528 - 573
Target Start/End: Complemental strand, 39446955 - 39446910
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
39446955 |
catgtaaccgaccccacttaatgggataaggcttggttgtggttgt |
39446910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 42293318 - 42293265
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| ||||||||| ||||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
42293318 |
atttaatctatgtagccggccccacttagtggaataaggcctggttgttgttgt |
42293265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 43774098 - 43774139
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
43774098 |
tagccgaccccatttagtgggataaggcttgattgttgttgt |
43774139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 562
Target Start/End: Original strand, 44360316 - 44360357
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||| |||||||||||||||||||| | |||||||||||| |
|
|
| T |
44360316 |
tttgattcatgtagccgaccccacttaataggataaggcttg |
44360357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 533 - 570
Target Start/End: Original strand, 44940738 - 44940775
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44940738 |
agccgaccccacttagtgggataagtcttggttgttgt |
44940775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 502 - 555
Target Start/End: Original strand, 47372862 - 47372915
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggata |
555 |
Q |
| |
|
|||||| ||||||| || |||||||||||||||| | |||||||||||||||| |
|
|
| T |
47372862 |
atagaacattatggagtcgtttgatccatgtagcccatcccacttagtgggata |
47372915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 532 - 573
Target Start/End: Original strand, 52357924 - 52357965
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||| |
|
|
| T |
52357924 |
tagccgacctcacttagtgggataaggcttggttgctgttgt |
52357965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 53708023 - 53708076
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
53708023 |
atttgatccatttagtcgacatcacttagtgggataaggcttgattgttgttgt |
53708076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 502 - 561
Target Start/End: Complemental strand, 4011401 - 4011344
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||| |||| |||||||| |||||| |
|
|
| T |
4011401 |
atagaacattatggggtaatttgatccatg--gccgaccgcactaagtgggatcaggctt |
4011344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 524 - 556
Target Start/End: Complemental strand, 17666099 - 17666067
Alignment:
| Q |
524 |
gatccatgtagccgaccccacttagtgggataa |
556 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
17666099 |
gatccatgtagtcgaccccacttagtgggataa |
17666067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 20654868 - 20654920
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||| ||| | ||||||||| |
|
|
| T |
20654868 |
tttgattcatgtatccgaccccacttagtgagataagacttagttgttgttgt |
20654920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 35555702 - 35555650
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||| ||||||||| |||| |||| |
|
|
| T |
35555702 |
tttgattcatgtagccgactccatttagtgggacaaggcttggttgtttttgt |
35555650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 36556812 - 36556760
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | |||| |||||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
36556812 |
tttgattcgtgtacccgaccccactttgtgggataagacttggttgttgttgt |
36556760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 42639095 - 42639019
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| ||||||| || | | || ||||||||| ||||| |||||||||||||||| || |||||||||| |
|
|
| T |
42639095 |
tttgatagaacattatggcgtcgtgtaattcatgtagccaaccccgcttagtgggataaggcatgcttgttgttgta |
42639019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 518 - 562
Target Start/End: Complemental strand, 46715322 - 46715278
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
46715322 |
taattcgatccatgtaactgaccccacttagtgggataagacttg |
46715278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 537 - 573
Target Start/End: Original strand, 49370040 - 49370076
Alignment:
| Q |
537 |
gaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
49370040 |
gaccccacttagtgggatatggcttggttgttgttgt |
49370076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 5e-24; HSPs: 138)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 9531673 - 9531600
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9531673 |
tgatggaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
9531600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 12734909 - 12734982
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12734909 |
tgatagaacactatggtgtaatttgatccatgtagtcgaccccacttagtgggataaggcttggttgttgttgt |
12734982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 3635398 - 3635323
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3635398 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
3635323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 510 - 573
Target Start/End: Complemental strand, 43573193 - 43573130
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43573193 |
ttatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
43573130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 500 - 562
Target Start/End: Complemental strand, 3720488 - 3720426
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3720488 |
tgatagaacattatggtgtaatttgatccatgtagccgaccccacttagtgggagaaggcttg |
3720426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 12475000 - 12474926
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12475000 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
12474926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 12520124 - 12520062
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12520124 |
tatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
12520062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 227398 - 227471
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
227398 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
227471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 9496075 - 9496148
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
9496075 |
tgatagaacattatggcgtaatttgatccatgtagccaaccccacttagtgggacaaggcttggttgttgttgt |
9496148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 28508887 - 28508960
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28508887 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
28508960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 30306241 - 30306314
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30306241 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
30306314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 569
Target Start/End: Original strand, 33504433 - 33504502
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33504433 |
tgatagaacattatggcgtaatttgatccatctagccgaccccacttagtgggataaggcttggttgttg |
33504502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 501 - 573
Target Start/End: Original strand, 4807805 - 4807877
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4807805 |
gatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
4807877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 498 - 574
Target Start/End: Complemental strand, 11992183 - 11992107
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||| ||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
11992183 |
tttgatagaacattatggcgttatttgatccatgtagctgaccccacttagtggaataaggcttggttgttgttgta |
11992107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 511 - 574
Target Start/End: Complemental strand, 38452748 - 38452685
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38452748 |
tatggtgtcattcgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgta |
38452685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 503 - 573
Target Start/End: Original strand, 11412922 - 11412992
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||| ||||||||||||| ||||||||| |
|
|
| T |
11412922 |
tagaacattatggtgtaatttgatccatgtagccgaactcacttagtaggataaggcttggttgttgttgt |
11412992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 17670688 - 17670750
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17670688 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
17670750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 451721 - 451648
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
451721 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggacaaggcttggttgttgttgt |
451648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 3481363 - 3481436
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| ||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
3481363 |
tgatagaacattatggcgtaatttgatccatgtagctgaccccacttagttggaaaaggcttggttgttgttgt |
3481436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 6219174 - 6219247
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||| |||| ||||||||||||| |||| |||| |
|
|
| T |
6219174 |
tgatagaacattatggtgtaatttgatccatgtagccaaccccacctagttggataaggcttggttgttattgt |
6219247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 7326233 - 7326160
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7326233 |
tgatagaacactatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttgttgttgt |
7326160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 9556442 - 9556369
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||| ||||||||||||| |||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
9556442 |
tgatagaacattagggtgtaatttgatacatgtagccgactccacttagtgggatgaggcttggttgttgttgt |
9556369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 12882118 - 12882045
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
12882118 |
tgatagaacattttggcgtaatttgatccatgtagcctacctcacttagtgggataaggcttggttgttgttgt |
12882045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 25834907 - 25834960
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25834907 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
25834960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 36183660 - 36183733
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
36183660 |
tgatagaacactatggtgccatttgatccatgtagccgaccccacttagtaggataaggcttggttgttgttgt |
36183733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 38328423 - 38328370
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38328423 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
38328370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 38435161 - 38435234
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||| ||||||| |||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38435161 |
tgattgaacattatggcgtaatttgatccatgtagccgatcccacttagtggcataaggcttggttgttgttgt |
38435234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 511 - 572
Target Start/End: Complemental strand, 39709263 - 39709202
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
39709263 |
tatggcgtaatttgatccatgtagccgaccccacttagtgggatatggcttggttgttgttg |
39709202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 41763096 - 41763043
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41763096 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
41763043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 3243726 - 3243654
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| | ||||| || |||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3243726 |
tgatagaacactatggcgtcatttgatccaggtagccgaccccacttagtgggataaggcttggttgttgttg |
3243654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 519 - 575
Target Start/End: Complemental strand, 16521061 - 16521005
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
16521061 |
aatttgatccatgtagccgaccccacttagtgggataaggctcggttgttgttgtag |
16521005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 500 - 572
Target Start/End: Original strand, 18959120 - 18959192
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||| | |||||| |
|
|
| T |
18959120 |
tgatagaacattatggcataatttgatccatgtagctgaccccacttagtgggataaggcttggttattgttg |
18959192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 500 - 571
Target Start/End: Original strand, 8180989 - 8181060
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| | ||| |||| |||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
8180989 |
tgatagaacactatagtgtcatttgatccatgtagccgaccccacttagtgggataaggcttcgttgttgtt |
8181060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Original strand, 38430091 - 38430165
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | ||||| || ||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
38430091 |
tttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgagataaggcttgg-tgttgttgt |
38430165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 41197302 - 41197227
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||||||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
41197302 |
tttgatagaacattatggcgtcatttgatccatgtagtcgaccccacttgatgggataaggcttggttgttgttgt |
41197227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 499 - 572
Target Start/End: Complemental strand, 887139 - 887065
Alignment:
| Q |
499 |
ttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataa-ggcttggctgttgttg |
572 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
887139 |
ttgatagaacattatggcgtaatttgatccatgtagctgaccccacttggtgggataatggcttggttgttgttg |
887065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Complemental strand, 10516822 - 10516748
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||| || | |||||||||||||||||||||| |||||||||| |
|
|
| T |
10516822 |
tgataaaatattatggcgtaatttgatccatgtagctgatctcacttagtgggataaggcttggttgttgttgta |
10516748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 17429259 - 17429333
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| |||||| ||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
17429259 |
tgatagaacattatgacataatttgattcatgtagccgaccccacttagtgagataaggcttggttgttgttgta |
17429333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 500 - 574
Target Start/End: Original strand, 31959730 - 31959804
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
31959730 |
tgatagaacactatggcataatttgatccatgtagcagaccccacttagtaggataaggcttggttgttgttgta |
31959804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 2610797 - 2610870
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||| |||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
2610797 |
tgatagaacactatggcgttatttgatccatgtaaccgaccccacttagtgagataaggcttggttgttgttgt |
2610870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 3866301 - 3866354
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
3866301 |
atttgatccatgtagccgaccccacttagtaggataaggcttggttgttgttgt |
3866354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 8197614 - 8197541
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
8197614 |
tgatagaatattatggcgtcgtttgatccatgtagccgaccctacttagtgggataatgcttggttgttgttgt |
8197541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 8202374 - 8202301
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
8202374 |
tgatagaatattatggcgtcgtttgatccatgtagccgaccctacttagtgggataatgcttggttgttgttgt |
8202301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 19863443 - 19863516
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
19863443 |
tgatagaacattatggcatgatttgatccatgtagccgtccccacttagtgggataaagcttggttgttgttgt |
19863516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 19867775 - 19867848
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
19867775 |
tgatagaacattatggcatgatttgatccatgtagccgtccccacttagtgggataaagcttggttgttgttgt |
19867848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 19872676 - 19872749
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
19872676 |
tgatagaacattatggcatgatttgatccatgtagccgtccccacttagtgggataaagcttggttgttgttgt |
19872749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 42549910 - 42549837
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| || |||| |||||||||| ||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
42549910 |
tgatagaacatcatggcgtaatttgattcatgtagccaaccccacttagtgggataaagcttggttgttgttgt |
42549837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 12489854 - 12489802
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12489854 |
tttgattcatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
12489802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 498 - 578
Target Start/End: Complemental strand, 44437796 - 44437716
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagttc |
578 |
Q |
| |
|
|||||||||| | ||||| || ||| || |||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
44437796 |
tttgatagaacactatggcgttgtttaattcatgtagccgaccccacttagtgggataaggcttggttgttgttgttgttc |
44437716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 45543146 - 45543074
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||| ||| ||||||| |||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
45543146 |
tgatagaacattatggcgtactttgatctatgtagccgaccccacttagtgggataatgcttgcttgttgttg |
45543074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 510 - 573
Target Start/End: Original strand, 14444888 - 14444951
Alignment:
| Q |
510 |
ttatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14444888 |
ttatggcgtactttgatccatgtagccatccccacttagtgggataaggcttggttgttgttgt |
14444951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 502 - 573
Target Start/End: Original strand, 25384680 - 25384751
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| | ||||| |||||||||||||||||||| ||| |||||||||||||||||||||| |||||||| |
|
|
| T |
25384680 |
atagaacactatggcgtaatttgatccatgtagccaacctcacttagtgggataaggcttggtggttgttgt |
25384751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 35755318 - 35755247
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||| || ||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
35755318 |
tgatagaacattgtgccgtaatttgatccatgcagccgaccctacttagtgggataaggcttggttgttgtt |
35755247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 498 - 572
Target Start/End: Complemental strand, 624761 - 624687
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||||| |||||| || |||||| ||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
624761 |
tttgatagaacgctatggtatagtttgattcatgtagccgaccccgcttagtgggataaggcttggttgttgttg |
624687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 509 - 574
Target Start/End: Complemental strand, 2902025 - 2901959
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagcc-gaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
2902025 |
attatggtgtaatttgatccttgtagcccgaccccacttagtggaaaaaggcttggttgttgttgta |
2901959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 19336966 - 19336896
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| | |||||||| |||||||| |||||| |||||| |
|
|
| T |
19336966 |
tgatagaacattatggcgtaatttgatccatgtagccaatcccacttattgggataaagcttggttgttgt |
19336896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 519 - 569
Target Start/End: Complemental strand, 45483039 - 45482989
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggcttggctgttg |
569 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45483039 |
aatttgatctatgtagccgaccccacttagtgggataaggcttggttgttg |
45482989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 15775898 - 15775845
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
15775898 |
atttggtccatgtagccgaccccacttagtggaataaggcttggttgttgttgt |
15775845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 528 - 573
Target Start/End: Original strand, 35643185 - 35643230
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35643185 |
catgtagccgaccccacttagtgggataaggcttggttgttgttgt |
35643230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 502 - 562
Target Start/End: Complemental strand, 2515242 - 2515182
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||| ||||||| ||| ||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
2515242 |
atagaatattatggcgtactttgatctatctagccgaccccacttagtgggataaggcttg |
2515182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 518 - 577
Target Start/End: Complemental strand, 9996681 - 9996619
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccactt---agtgggataaggcttggctgttgttgtagtt |
577 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
9996681 |
taatttgatccatgtagccgaccccacttagaagagggataaggcttggttgttgttgtagtt |
9996619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 501 - 573
Target Start/End: Complemental strand, 21281535 - 21281463
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||||||| |||||||||||||| |||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
21281535 |
gatagaacattatggcttaatttgatccatgcagccaaccccaattagtgggataaggcttggtagttgttgt |
21281463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 500 - 560
Target Start/End: Complemental strand, 37470206 - 37470146
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggct |
560 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
37470206 |
tgatagaacattatggtgtagtttgatccatgtagctaatcccacttagtgggataaggct |
37470146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 498 - 571
Target Start/End: Original strand, 39029788 - 39029867
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgta------gccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39029788 |
tttgatagaacattatggcgtcatttgatccatgtaggtgtagccgaccccacttagtgggataaggcttggttgttgtt |
39029867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 42543465 - 42543517
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42543465 |
tttgattcatgtagccggccccacttagtgggataaggcttggttgttgttgt |
42543517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 5759070 - 5758995
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | |||||||| |||||| || ||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
5759070 |
tttgatagaacactatggtgtcgtttgattcaggtagctgaccccacttagttggataaggcttggttgttgttgt |
5758995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 502 - 561
Target Start/End: Complemental strand, 13443979 - 13443920
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||| ||||||| || |||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
13443979 |
atagaacattatggcgtcatttgatcgatgtagccgaccccatttagtgggataaggctt |
13443920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 563
Target Start/End: Original strand, 26670977 - 26671040
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
26670977 |
tgatagaatataatggtgtaatttgatccatgtagccgacactgcttagtgggataagacttgg |
26671040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 32364994 - 32364923
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| |||| |||||| | ||| ||||||||| ||||||| |
|
|
| T |
32364994 |
tgatagaacattatggtgtaatttgatcaatgtagctgacctcacttaataggaaaaggcttggttgttgtt |
32364923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 571
Target Start/End: Original strand, 34931641 - 34931712
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
34931641 |
tgatagaacattatggcataatttgatccatatagccgaccgtacttagtgggacaaggcttggttgttgtt |
34931712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 532 - 574
Target Start/End: Complemental strand, 2073348 - 2073306
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2073348 |
tagccgaccccacttagtgggataaggcttggttgttgttgta |
2073306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 498 - 572
Target Start/End: Complemental strand, 37481692 - 37481618
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||| ||||||||| |||| ||||||||| ||| |||||||| |
|
|
| T |
37481692 |
tttgatagaaaattatggtgtcttttgattcatctagtcgaccccacgtagtcggataaggcgtggttgttgttg |
37481618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 500 - 570
Target Start/End: Original strand, 45077938 - 45078008
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| || |||| |||||||||||||||| |||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
45077938 |
tgatagaacataatggcataatttgatccatgtaaccgaccccacttagtgagataaagcttggttgttgt |
45078008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 532 - 573
Target Start/End: Complemental strand, 10403934 - 10403893
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10403934 |
tagccgaccccacttagtgggataaggcttggttgttgttgt |
10403893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 32402709 - 32402782
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||| | |||||||||| |||| ||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
32402709 |
tgatagaacattatggtttcatttgatccacgtagacgatcctgcttagtgggataagacttggctgttgttgt |
32402782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 517 - 574
Target Start/End: Original strand, 36993761 - 36993817
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
36993761 |
gtaatttgatccatgtagcctacca-acttagtgggataaggcttggttgttgttgta |
36993817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 500 - 576
Target Start/End: Original strand, 3030888 - 3030963
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtagt |
576 |
Q |
| |
|
||||| || ||||||| |||||| ||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
3030888 |
tgatacaacattatggcataattttatccatgtagc-gaccccacttagtgggataagccttggtcgttgttgtagt |
3030963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 33393339 - 33393391
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| |||||| ||||||||| |
|
|
| T |
33393339 |
tttgatccatgtaaccgaccccacttactgggataaagcttggttgttgttgt |
33393391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 33971534 - 33971586
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||| ||||||||| |
|
|
| T |
33971534 |
tttgatccatgtagccgaccccacctagtgggatatggcatggttgttgttgt |
33971586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 533 - 573
Target Start/End: Original strand, 38429651 - 38429691
Alignment:
| Q |
533 |
agccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38429651 |
agccgaccccacttagtgggataaggcttggttgttgttgt |
38429691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 500 - 563
Target Start/End: Original strand, 440925 - 440988
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||| ||| |||||||| |||||||| ||||| |
|
|
| T |
440925 |
tgatacaacattatggcgtaatttgatccatgtagctgactccacttagagggataagacttgg |
440988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 28960286 - 28960211
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| | |||||||| |||||| ||||||| |||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
28960286 |
tttgatagagcactatggtgtcgtttgattcatgtagtcgactccatttagtgggataaggcttggttgttgttgt |
28960211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 534 - 573
Target Start/End: Original strand, 37520689 - 37520728
Alignment:
| Q |
534 |
gccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37520689 |
gccgaccccacttagtgggataaggcttggttgttgttgt |
37520728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 498 - 573
Target Start/End: Complemental strand, 45367700 - 45367625
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| | |||| || ||||||||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
45367700 |
tttgatagaacactatgacgtcatttgatccatgtcgccgaccccacttagtgggataaaacttgtttgttgttgt |
45367625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 527 - 573
Target Start/End: Complemental strand, 8560852 - 8560806
Alignment:
| Q |
527 |
ccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
8560852 |
ccatgtagccgacccaacttagtgggataagacttggttgttgttgt |
8560806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 571
Target Start/End: Complemental strand, 12026064 - 12026014
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | |||| ||||||| |
|
|
| T |
12026064 |
tttgatccatgtagctgaccccacttagtgggataaagtttggttgttgtt |
12026014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 17626292 - 17626354
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||| ||||||||||||| || |||| |||||||||||||||| ||||||||| |
|
|
| T |
17626292 |
tatggcgtcatttgttccatgtagccgaaccaactttgtgggataaggcttggttgttgttgt |
17626354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 520 - 574
Target Start/End: Complemental strand, 18424430 - 18424377
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
18424430 |
atttgatccatgta-ccgtccccacttagtgggataagacttggttgttgttgta |
18424377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 500 - 577
Target Start/End: Original strand, 26850443 - 26850521
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgt-agccgaccccacttagtgggataaggcttggctgttgttgtagtt |
577 |
Q |
| |
|
||||| || ||||||| |||||||| || |||| |||| |||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
26850443 |
tgataaaacattatggcgtaatttgttcgatgttagccaaccccacttagtgggaaaaggtttggttgttgttgtagtt |
26850521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 509 - 574
Target Start/End: Original strand, 32443854 - 32443920
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagt-gggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |||||||| ||| | |||||||||| |
|
|
| T |
32443854 |
attatggcataatttgatccatgtagccgactccacttagtggggataagacttagttgttgttgta |
32443920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 519 - 561
Target Start/End: Complemental strand, 44877487 - 44877445
Alignment:
| Q |
519 |
aatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44877487 |
aatttggtccatgtagccgaccccacttcgtgggataaggctt |
44877445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 512 - 573
Target Start/End: Complemental strand, 7431950 - 7431889
Alignment:
| Q |
512 |
atggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||||||| | |||||| ||||||||||||||| |||| | ||||||||| |
|
|
| T |
7431950 |
atggtgtcatttgatccatgcaaccgacctcacttagtgggataaagcttagttgttgttgt |
7431889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 528 - 573
Target Start/End: Complemental strand, 12470942 - 12470897
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12470942 |
catgtagccgaccccatttagtgggataaggcttggtggttgttgt |
12470897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 14398031 - 14397958
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||||||| ||||| |||| |||| || || ||||||||||||||| ||||| ||||||||| |
|
|
| T |
14398031 |
tgatagaacattatggtgtcatttgttccacatagctgatcctacttagtgggataagacttggttgttgttgt |
14397958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 15222474 - 15222527
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||| ||||| ||||||||| |
|
|
| T |
15222474 |
atttgatccatgtagccaaccccacctagtaggataagacttggttgttgttgt |
15222527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 498 - 563
Target Start/End: Original strand, 19024385 - 19024450
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||| |||||| || ||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
19024385 |
tttgatagaactttatggcgtcgtttgatctatatagccgaccccactcagtgggataaggcttgg |
19024450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 525 - 574
Target Start/End: Original strand, 19855696 - 19855745
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||||||||||||||||||||| |||||| || ||| |||||||||| |
|
|
| T |
19855696 |
atccatgtagccgaccccacttagtaggataaagcgtggttgttgttgta |
19855745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 528 - 573
Target Start/End: Original strand, 26566292 - 26566337
Alignment:
| Q |
528 |
catgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
26566292 |
catgtagccaaccccacttagtgggttaaggcttggttgttgttgt |
26566337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 502 - 551
Target Start/End: Original strand, 36366847 - 36366896
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgg |
551 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || |||||| ||||||| |
|
|
| T |
36366847 |
atagaacattatggtgtaatttgatccatgtatccaaccccatttagtgg |
36366896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 43752020 - 43751947
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||| ||||||| |||||||| ||| |||||| | ||||||||| |
|
|
| T |
43752020 |
tgatagaacactatgttgtaatttgatccatgtggccgacctcacttagttggaaaaggctcagttgttgttgt |
43751947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 43832327 - 43832380
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
43832327 |
atttgatccatgtagctgacccaacttagtttgataaggcttggttgttgttgt |
43832380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 574
Target Start/End: Original strand, 44415853 - 44415906
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
44415853 |
tttgatccatgttgccaaccctgcttagtgggataaggcttggttgttgttgta |
44415906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 518 - 570
Target Start/End: Complemental strand, 186187 - 186135
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||| ||||| ||||||| ||||||||||||||| |||||| |||||| |
|
|
| T |
186187 |
taatttgattcatgtggccgacctcacttagtgggataaagcttggttgttgt |
186135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 15015175 - 15015227
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||||||||||||| || |||||| |
|
|
| T |
15015175 |
tttgattcatgtagccgacgcaacttagtgggataaggcttggttgctgttgt |
15015227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 15025724 - 15025776
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| ||||||||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
15025724 |
tttgattcatgtagccgatgcaacttagtgggataaggcttggttgttgttgt |
15025776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 521 - 557
Target Start/End: Original strand, 15836170 - 15836206
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataag |
557 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15836170 |
tttggtccatgtagccgaccccacttagtgggataag |
15836206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 509 - 556
Target Start/End: Original strand, 23354097 - 23354145
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccga-ccccacttagtgggataa |
556 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23354097 |
attacggtgtcatttgatccatgtagccgacccccacttagtgggataa |
23354145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 517 - 573
Target Start/End: Original strand, 24214012 - 24214068
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||||||||||||||| | |||||||||| |||| ||||||||| |
|
|
| T |
24214012 |
gtaatttaatccatgtagccgaccccaccttgtgggataagatttggttgttgttgt |
24214068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 517 - 573
Target Start/End: Complemental strand, 24583687 - 24583631
Alignment:
| Q |
517 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| ||| |||| |||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
24583687 |
gtaatttaatcaatgttgccgaccccacttaatgagataaggcttggttgttgttgt |
24583631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 509 - 548
Target Start/End: Complemental strand, 1830234 - 1830195
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttag |
548 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1830234 |
attatggtgtaatttaatccatgtagccaaccccacttag |
1830195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 531 - 570
Target Start/End: Original strand, 11414571 - 11414610
Alignment:
| Q |
531 |
gtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11414571 |
gtagccgacaccacttagtgggataaggcttggttgttgt |
11414610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 538 - 573
Target Start/End: Original strand, 13188389 - 13188424
Alignment:
| Q |
538 |
accccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13188389 |
accccacttagtgggataaggcttggttgttgttgt |
13188424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 520 - 551
Target Start/End: Original strand, 28367352 - 28367383
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgg |
551 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28367352 |
atttgatccatgtagccgaccccacttagtgg |
28367383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 560
Target Start/End: Complemental strand, 29968663 - 29968624
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggct |
560 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
29968663 |
tttgattcatgtagccgactccacttagtgggataaggct |
29968624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 498 - 553
Target Start/End: Original strand, 45437049 - 45437104
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
|||||||||| |||| |||||||||||||| |||||||| ||| |||| ||||||| |
|
|
| T |
45437049 |
tttgatagaacattacggtgtaatttgatctatgtagccaacctcactcagtggga |
45437104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 539 - 573
Target Start/End: Original strand, 1648112 - 1648146
Alignment:
| Q |
539 |
ccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1648112 |
ccccacttagtgggataaggcttggttgttgttgt |
1648146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 575
Target Start/End: Original strand, 16113674 - 16113728
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgtag |
575 |
Q |
| |
|
||||||| ||||||||||| ||| ||||||||| ||| ||||| ||||||||||| |
|
|
| T |
16113674 |
tttgatctatgtagccgactccatttagtgggagaagacttggttgttgttgtag |
16113728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 558
Target Start/End: Complemental strand, 23915766 - 23915708
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataagg |
558 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||| |||||||||||| | || |||||||| |
|
|
| T |
23915766 |
tgatagaacactatggcgtaatttgatccatgcagccgaccccacatggtcggataagg |
23915708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 500 - 566
Target Start/End: Complemental strand, 26784413 - 26784347
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctg |
566 |
Q |
| |
|
||||| || ||| |||| ||||||||||||||||||| | | |||||||| ||||||| |||||||| |
|
|
| T |
26784413 |
tgataaaacattttggtttaatttgatccatgtagccaatctcacttagtaggataagacttggctg |
26784347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 509 - 563
Target Start/End: Complemental strand, 38810641 - 38810587
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||| ||||| | |||||||| |||| |
|
|
| T |
38810641 |
attatggtgttatttgatccatgtagccaaccctacttaataggataaggtttgg |
38810587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 335785 - 335712
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||| || ||||||||||||| |||| | ||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
335785 |
tgatagaacattacggcataatttgatccatatagcaggccccacttagtaggatatagcttggttgttgttgt |
335712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 512 - 573
Target Start/End: Complemental strand, 1765672 - 1765611
Alignment:
| Q |
512 |
atggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||| |||||||||||| ||||| |||||||| |||||| ||| || ||||||||| |
|
|
| T |
1765672 |
atggtctaatctgatccatgtagtcgacctcacttagtaggataaagctcggttgttgttgt |
1765611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 498 - 563
Target Start/End: Complemental strand, 4598637 - 4598572
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||||||| | ||||| || ||||||| |||||| |||| |||||||| |||||||||||||| |
|
|
| T |
4598637 |
tttgatagaacactatggcgtcatttgattcatgtaaccgattccacttagcgggataaggcttgg |
4598572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 509 - 574
Target Start/End: Complemental strand, 13474278 - 13474213
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
||||||| |||||||||| || || |||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
13474278 |
attatggcataatttgatctattgagtcgactccacttagtgggataagacttggttgttgttgta |
13474213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 549
Target Start/End: Original strand, 19224990 - 19225039
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagt |
549 |
Q |
| |
|
|||||||| | |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
19224990 |
tgatagaacactatgatgtcgtttgatccatgtagccgaccccacttagt |
19225039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 532 - 573
Target Start/End: Complemental strand, 25284997 - 25284956
Alignment:
| Q |
532 |
tagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
25284997 |
tagccgactccacttactgggataaggcttggttgttgttgt |
25284956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 33287630 - 33287703
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| |||||| || |||||||| ||||||| || ||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
33287630 |
tgatagaacattatgacatagtttgatccttgtagccaactccacttagtgggacaagacttggttgttgttgt |
33287703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 570
Target Start/End: Original strand, 42092747 - 42092796
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
||||||||||||||| ||||| ||||||| |||| |||||||| |||||| |
|
|
| T |
42092747 |
tttgatccatgtagctgaccctacttagtaggattaggcttggttgttgt |
42092796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 511 - 571
Target Start/End: Original strand, 522449 - 522509
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||| || |||||||||||||||| || | |||||| ||||||||||||| | ||||||| |
|
|
| T |
522449 |
tatggcgtcatttgatccatgtagcagatcacacttaatgggataaggctttgttgttgtt |
522509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 9394694 - 9394630
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||| |||||||||||| ||||||||| || ||||||| ||| | ||||||||| |
|
|
| T |
9394694 |
attatggcttaattttatccatgtagccaaccccacttggtaggataagactttgttgttgttgt |
9394630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 503 - 547
Target Start/End: Complemental strand, 9554140 - 9554096
Alignment:
| Q |
503 |
tagaaaattatggtgtaatttgatccatgtagccgaccccactta |
547 |
Q |
| |
|
||||| ||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
9554140 |
tagaacattatggtgtagtttaattcatgtagccgaccccactta |
9554096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 509 - 553
Target Start/End: Original strand, 12013168 - 12013212
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtggga |
553 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
12013168 |
attatggtgtaatttgattcatgtcaccgaccccatttagtggga |
12013212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 13240815 - 13240763
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||| |||||||| |||||||||||||||||||| | ||||||| |
|
|
| T |
13240815 |
tttgatccgtgtcgccgacccagcttagtgggataaggcttggttattgttgt |
13240763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 525 - 561
Target Start/End: Complemental strand, 19235032 - 19234996
Alignment:
| Q |
525 |
atccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19235032 |
atccatgtagccaactccacttagtgggataaggctt |
19234996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 32395599 - 32395651
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |||||| | |||| ||||||||| |
|
|
| T |
32395599 |
tttgatgcatgtagccgaccccatttagttggataaagtttggttgttgttgt |
32395651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Original strand, 36819406 - 36819457
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| |||||| | ||||||| |
|
|
| T |
36819406 |
tttgatccatatagccgaccc-acttagtgggataaagcttggttattgttgt |
36819457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 520 - 548
Target Start/End: Complemental strand, 39592442 - 39592414
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttag |
548 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39592442 |
atttgatccatgtagccgaccccacttag |
39592414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 536 - 568
Target Start/End: Complemental strand, 45653502 - 45653470
Alignment:
| Q |
536 |
cgaccccacttagtgggataaggcttggctgtt |
568 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
45653502 |
cgaccccacttagtgggataaggcttggttgtt |
45653470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 28962 - 28889
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28962 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
28889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1318 (Bit Score: 50; Significance: 3e-19; HSPs: 1)
Name: scaffold1318
Description:
Target: scaffold1318; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 540 - 613
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
540 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttgattgttgttgt |
613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0392 (Bit Score: 50; Significance: 3e-19; HSPs: 1)
Name: scaffold0392
Description:
Target: scaffold0392; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 6845 - 6772
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6845 |
tgatataacattatggcataatttgatccatgtagccaaccccacttagtgggataaggcttggctgttattgt |
6772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 50; Significance: 3e-19; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 520 - 573
Target Start/End: Original strand, 31697 - 31750
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31697 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttgt |
31750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 49; Significance: 1e-18; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 498 - 574
Target Start/End: Original strand, 16785 - 16861
Alignment:
| Q |
498 |
tttgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||| | ||||| || |||||||| ||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16785 |
tttgatagaacactatggcgtcatttgatctatgtagccgactccacttagtgggataaggcttggttgttgttgta |
16861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692 (Bit Score: 46; Significance: 7e-17; HSPs: 1)
Name: scaffold0692
Description:
Target: scaffold0692; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Original strand, 4845 - 4918
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| |||||||||||| ||||||||||||||||| ||||||||| |||||| ||||||||| |
|
|
| T |
4845 |
tgatagaacactatggcgtaatttgatccgtgtagccgaccccactttgtgggataacgcttggttgttgttgt |
4918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0570 (Bit Score: 46; Significance: 7e-17; HSPs: 1)
Name: scaffold0570
Description:
Target: scaffold0570; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 1021 - 948
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | ||||| || |||||||||||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
1021 |
tgatagaacactatggcgtcatttgatccatgtagctgaccccatttagtgggataaggcttggttgttgttgt |
948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 46; Significance: 7e-17; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 500 - 561
Target Start/End: Complemental strand, 58299 - 58238
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggctt |
561 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
58299 |
tgatagaacattatgtcgtaatttgatccatgtagccgacccaacttagtgggataaggctt |
58238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 500 - 572
Target Start/End: Complemental strand, 160397 - 160325
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttg |
572 |
Q |
| |
|
|||||||| ||||||| ||||||||| ||||||||| |||||||||||||||| ||||||||| |||||||| |
|
|
| T |
160397 |
tgatagaacattatggcgtaatttgaatcatgtagccaaccccacttagtgggaaaaggcttggttgttgttg |
160325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 500 - 570
Target Start/End: Complemental strand, 48189 - 48119
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgt |
570 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| ||||||||| |||| |||||| | |||||| |
|
|
| T |
48189 |
tgatagaatattatggcgtaatttgatccatgtagccgactccacttagtaggattaggcttagttgttgt |
48119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 520 - 574
Target Start/End: Original strand, 82947 - 83001
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgta |
574 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
82947 |
atttgatccatgtagccgaccccacttaatggaataaggcttggttgttgttgta |
83001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0491 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0491
Description:
Target: scaffold0491; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 502 - 563
Target Start/End: Original strand, 3648 - 3709
Alignment:
| Q |
502 |
atagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
563 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
3648 |
atagaacattatgacgtaatttgatccaagtagccgaccccacttagtgggataagacttgg |
3709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0491; HSP #2
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 518 - 562
Target Start/End: Complemental strand, 3883 - 3839
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttg |
562 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||| |||||| |
|
|
| T |
3883 |
taatttgatcaatgtagtcgaccccaattagtgggatatggcttg |
3839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 25585 - 25532
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25585 |
atttaatccatgtagcggaccccacttagtgggataaggcttggttgttgttgt |
25532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0245 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0245
Description:
Target: scaffold0245; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 500 - 571
Target Start/End: Complemental strand, 16509 - 16438
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||||||| ||| ||||||||||| | ||||||| |
|
|
| T |
16509 |
tgatagaacattatggcataatttgatccatgtggccgaccccactcagttggataaggcttagttgttgtt |
16438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 511 - 573
Target Start/End: Original strand, 14803 - 14865
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
14803 |
tatggcgtaatttgatccatgtagccaaccccacgtagtgggataaatcttggttgttgttgt |
14865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 520 - 573
Target Start/End: Complemental strand, 11602 - 11549
Alignment:
| Q |
520 |
atttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||| || |||||| |
|
|
| T |
11602 |
atttgatccatgtagccgaccccacttagtaggataaggtttggttgctgttgt |
11549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 501 - 571
Target Start/End: Original strand, 7650 - 7720
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
||||||| | ||||| ||||||||||||||| |||| | |||||||||||||||| |||||| ||||||| |
|
|
| T |
7650 |
gatagaacactatggcgtaatttgatccatgcagccatctccacttagtgggataaagcttggttgttgtt |
7720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 511 - 573
Target Start/End: Complemental strand, 99348 - 99286
Alignment:
| Q |
511 |
tatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
99348 |
tatggtgtcgtttgaatcatgtagccgacaccacatagtgggataaggcttggttgttgttgt |
99286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 518 - 571
Target Start/End: Original strand, 26047 - 26100
Alignment:
| Q |
518 |
taatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgtt |
571 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
26047 |
taatttgagccatgtagccgaccccacttagtacgataaggcttgcttgttgtt |
26100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1259 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold1259
Description:
Target: scaffold1259; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 501 - 573
Target Start/End: Complemental strand, 1594 - 1522
Alignment:
| Q |
501 |
gatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||| ||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||||| |
|
|
| T |
1594 |
gatagaacattatgacgtaatttgatcaatgtagctgaccccacttattaagataaagcttggttgttgttgt |
1522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 509 - 560
Target Start/End: Original strand, 194084 - 194135
Alignment:
| Q |
509 |
attatggtgtaatttgatccatgtagccgaccccacttagtgggataaggct |
560 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||| |||||| |||||||| |
|
|
| T |
194084 |
attatggtgtcatttgatccatgtagccaatcccacctagtggaataaggct |
194135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 523 - 573
Target Start/End: Original strand, 19149 - 19199
Alignment:
| Q |
523 |
tgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| | |||| ||||||||| |
|
|
| T |
19149 |
tgatccacgtagccgaccccacttagtgagataaagtttggttgttgttgt |
19199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 500 - 573
Target Start/End: Complemental strand, 86682 - 86609
Alignment:
| Q |
500 |
tgatagaaaattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||| || | ||||||||||||||| | |||| ||||||||| |
|
|
| T |
86682 |
tgatagaacactatgacgtaatttgatccatgtagtcggctccacttagtgggatacgacttgtttgttgttgt |
86609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 521 - 573
Target Start/End: Complemental strand, 25495 - 25443
Alignment:
| Q |
521 |
tttgatccatgtagccgaccccacttagtgggataaggcttggctgttgttgt |
573 |
Q |
| |
|
||||||| |||||| | | ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
25495 |
tttgatctatgtagtcaatcccactttgtgggataaggcttggttgttgttgt |
25443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University