View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_high_33 (Length: 271)
Name: NF1121_high_33
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 50 - 256
Target Start/End: Original strand, 6219039 - 6219245
Alignment:
| Q |
50 |
taagcttatcacacttcagctcacaatcctagggtttcttgaaaatttagggtgttacaactttcatatcccgtttggcataagaacaatgaattattaa |
149 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
6219039 |
taagcttatcacacgtcagctcacaatcctagggtttcttgaaaatttagggtgttacaactttcatatcccttttggcatatgaacaatgaattattaa |
6219138 |
T |
|
| Q |
150 |
aagaactaatcggagaacttcgtaatgtcccttttggcatatagttagatataatgtgagttttgcatcgctgttatgaacatcaaccatcggaaaaata |
249 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6219139 |
aagaactaatcggagaacttagtaatgtcccttttggcatatagttagatataatgtgagttttgcatcgctgttatgaacatcaaccatcggaaaaata |
6219238 |
T |
|
| Q |
250 |
ttgttgg |
256 |
Q |
| |
|
||||||| |
|
|
| T |
6219239 |
ttgttgg |
6219245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University