View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1121_high_35 (Length: 266)
Name: NF1121_high_35
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1121_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 42190685 - 42190580
Alignment:
| Q |
1 |
agtaccgatctcataatagttatgaaatgtattttaaatgacatgataattttcagggttgagaatgtnnnnnnntatgctaattgttggcggccaactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
42190685 |
agtaccgatctcataatagttatgaaatgtattttaaatgacatgataattttcagggttgagaatgtaaaaaaatatgctaattgttagcggccaactc |
42190586 |
T |
 |
| Q |
101 |
tcgggt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
42190585 |
tcgggt |
42190580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 42209193 - 42209158
Alignment:
| Q |
8 |
atctcataatagttatgaaatgtattttaaatgaca |
43 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42209193 |
atctcataatagttatgaaatgtatttaaaatgaca |
42209158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University